FIELD OF THE INVENTION
The present invention relates generally to tools useful for the discovery of drugs for the treatment of conditions associated with melanin concentrating hormone (MCH) receptor activation in humans and other animals. The invention is more specifically related to polypeptides comprising monkey MCH type 1 receptor (MCH1R) sequences, including monkey MCH1R and chimeric MCH receptors, and to polynucleotides encoding such polypeptides. Such polypeptides and polynucleotides may be used in the identification of agents that modulate MCH receptor activity.
BACKGROUND OF THE INVENTION
Melanin concentrating hormone, or MCH, is a cyclic 19 amino acid neuropeptide that functions as a regulator of food intake and energy balance. MCH is produced in the hypothalamus of many vertebrate species including man. MCH is also produced at various peripheral sites, including the gastrointestinal tract and testis.
The postulated role of MCH in feeding behavior and body weight has been confirmed by the finding that I.C.V. injection of MCH into the lateral ventrical of the hypothalamus increases caloric consumption in rats over similarly treated control animals. Furthermore, rats having the ob/ob genotype exhibit a 50 80% increase in MCH mRNA expression as compared to leaner ob/+ genotype mice. MCH knockout mice are leaner than their MCH-producing siblings due to hypophagia and an increased metabolic rate.
MCH activity is mediated via binding to specific cell surface receptors. Like other G protein-coupled receptors (e.g., neuropeptide Y (NPY) and beta-adrenergic receptors), MCH receptors are membrane-spanning proteins that consist of a single contiguous amino acid chain comprising an extracellular N-terminal domain, seven membrane-spanning alpha helical domains (connected by three intracellular loop domains alternating with three extracellular loop domains), and an intracellular C-terminal domain. Signal transduction is initiated by the binding of MCH to the receptor. This binding is believed to elicit conformational changes in the extracellular domains. When the receptor is functioning properly, these conformational changes are believed to propagate through the transmembrane domains and result in a coordinated change in the intracellular portions of the receptor. This precise alteration in the intracellular domains is believed to trigger the associated G-protein complex to modulate intracellular signaling.
The human MCH type 1 receptor (MCH1R) is a 353 amino acid G protein-coupled receptor, first reported by Lakaye, et al. (BBA (1998) 1401:216 220), and described in U.S. Pat. No. 6,291,195. MCH1R has also been known as SLC-1 (somatostatin-like receptor; see U.S. Pat. No. 6,008,012). Immunohistochemistry studies of rat brain sections indicate that the MCH1R receptor is widely expressed in the brain. MCH1R receptor expression has been found in the olfactory tubercle, cerebral cortex, substantia nigra, basal forebrain CA1, CA2, and CA3 field of the hippocampus, amygdala, and in nuclei in the hypothalamus, thalamus, midbrain and hindbrain. Strong signals have been observed in the ventromedial and dorsomedial nuclei of the hypothalamus, two areas of the brain known to be involved in feeding behavior. Upon binding MCH, MCH1R expressed in HEK 293 cell mediates a dose dependent release of intracellular calcium. Cells expressing MCH receptors have also been shown to exhibit a pertussis toxin sensitive dose-dependent inhibition of forskolin-elevated cyclic AMP, suggesting that the receptor couples to a G.sub.i/o G-protein alpha subunit.
Because MCH is an important regulator of food intake and energy balance, agents capable of modulating MCH receptor activity are highly desirable for the treatment of obesity, eating disorders (e.g., bulimia and anorexia), sexual disorders (e.g., anorgasmic or psychogenic impotence) and metabolic disorders, such as diabetes. Isolated MCH receptors (e.g., as components of membrane preparations), cells expressing such receptors and cloned MCH receptor genes are needed to facilitate the discovery of such agents.
Accordingly, there is a need in the art for the identification of additional MCH receptor sequences. The present invention fulfills this need, and provides further related advantages.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1A and 1B depict an alignment of the amino acid sequences of (a) cynomolgus macaque MCH1R long form (SEQ ID NO:56); (b) Cynomolgus macaque MCH1R (SEQ ID NO:2), (c) the human somatostatin-like protein recited in SEQ ID NO:2 of U.S. Pat. No. 6,008,012, (d) human MCH1R and (e) rat MCH1R.
FIG. 2A and 2B depict an alignment of the amino acid sequences of (a) Cynomolgus macaque MCH1R (SEQ ID NO:2), (b) Cynomolgus macaque MCH1R long form (SEQ ID NO:56); and (c) the human MCH1 recited as SEQ ID NO:2 of U.S. Pat. No. 6,291,195 (encoded by GenBank accession number AR169785).
DESCRIPTION OF THE SEQUENCE LISTING
SEQ ID NO:1 Cynomolgus macaque MCH1R DNA sequence SEQ ID NO:2 Cynomolgus macaque MCH1R amino acid sequence SEQ ID NO:3 Amino acid sequence of the His.sub.6x epitope SEQ ID NO:4 Amino acid sequence of the FLAG epitope SEQ ID NO:5 Human MCH1R DNA sequence SEQ ID NO:6 Human MCH1R amino acid sequence SEQ ID NO:7 5' Cynomolgus macaque MCH1R primer SEQ ID NO:8 3' Cynomolgus macaque MCH1R primer SEQ ID NO:9 Human NPY1 receptor DNA CDS only SEQ ID NO:10 Human NPY1 receptor amino acid sequence SEQ ID NO:11 Human NPY1 receptor BspE forward primer for CT SEQ ID NO:12 Human NPY1 receptor reverse primer for CT SEQ ID NO:13 Human NPY1 receptor BspE--Not I fragment for CT SEQ ID NO:14 Human NPY1 receptor IC3 Sense oligo SEQ ID NO:15 Human NPY1 receptor IC3 Antisense oligo SEQ ID NO:16 Human MCH1R plus BspE Site added for C-terminal chimeras SEQ ID NO:17 Human MCH1R/NPY1 IC3 chimera--DNA CDS only SEQ ID NO:18 Human MCH1R/NPY1 IC3 chimera--amino acid sequence SEQ ID NO:19 Human MCH1R/NPY1 C-terminal chimera--DNA CDS only SEQ ID NO:20 Human MCH1R/NPY1 C-terminal chimera--amino acid sequence SEQ ID NO:21 Human MCH1R/NPY1 IC3 chimera in pcDNA3.1Plus (pN105) SEQ ID NO:22 Human MCH1R/NPY1 C-terminal chimera in pcDNA3.1Plus (pN107) SEQ ID NO:23 Human beta-2 adrenergic receptor--DNA SEQ ID NO:24 Human beta-2 adrenergic receptor amino acid sequence SEQ ID NO:25 Human beta-2 adrenergic receptor C-terminal forward primer SEQ ID NO:26 Human beta-2 adrenergic receptor C-terminal reverse primer SEQ ID NO:27 Human MCH1R/beta-2 adrenergic receptor C-term. chimera--DNA CDS SEQ ID NO:28 Human MCH1R/beta-2 adrenergic receptor C-term. chimera--aa sequence SEQ ID NO:29 Human MCH1R/beta-2 adrenergic receptor C-term. chimera in pcDNA3.1Plus (pN125) SEQ ID NO:30 Amino acid residues 30 60 of SEQ ID NO:2 SEQ ID NO:31 Human MCH1R forward primer SEQ ID NO:32 Human MCH1R reverse primer SEQ ID NO:33 Cynomolgus macaque MCH2R clone A DNA sequence SEQ ID NO:34 Cynomolgus macaque MCH2R clone A amino acid sequence SEQ ID NO:35 Cynomolgus macaque MCH2R clone B DNA sequence SEQ ID NO:36 Cynomolgus macaque MCH2R clone B amino acid sequence SEQ ID NO:37 Cynomolgus macaque MCH2R DNA sequence SEQ ID NO:38 Canine MCH2R DNA sequence SEQ ID NO:39 Canine MCH2R amino acid sequence SEQ ID NO:40 Cynomolgus macaque MCH1R with BspE Site for C-term. chimeras SEQ ID NO:41 Cynomolgus macaque MCH1R/human NPY1 IC3 chimera--DNA seq. SEQ ID NO:42 Cynomolgus macaque MCH1R/human NPY1 IC3 chimera--aa sequence SEQ ID NO:43 Cynomolgus macaque MCH1R/human NPY1 C-term. chimera--DNA SEQ ID NO:44 Cynomolgus macaque MCH1R/human NPY1 C-term. chimera--aa seq. SEQ ID NO:45 Cynomolgus macaque MCH1R/human beta-2 adrenergic receptor C-terminal chimera--DNA sequence SEQ ID NO:46 Cynomolgus macaque MCH1R/human beta-2 adrenergic receptor C-terminal chimera--amino acid sequence SEQ ID NO:47 Cynomolgus macaque MCH1R/MCH2R N-terminal chimera--DNA SEQ ID NO:48 Cynomolgus macaque MCH1R/MCH2R N-terminal chimera--aa SEQ ID NO:49 Cynomolgus macaque MCH1R/MCH2R IC3 chimera--DNA sequence SEQ ID NO:50 Cynomolgus macaque MCH1R/MCH2R IC3 chimera--amino acid seq. SEQ ID NO:51 Cynomolgus macaque MCH1R/MCH2R C-terminal chimera--DNA SEQ ID NO:52 Cynomolgus macaque MCH1R/MCH2R C-terminal chimera--aa SEQ ID NO:53 Cynomolgus macaque MCH1R 5' extension--DNA sequence SEQ ID NO:54 Cynomolgus macaque MCH1R 5' extension--amino acid sequence SEQ ID NO:55 Cynomolgus macaque MCH1R long form 5'--DNA sequence SEQ ID NO:56 Cynomolgus macaque MCH1R long form 5'--amino acid sequence SEQ ID NO:57 MCH1R outer reverse primer SEQ ID NO:58 MCH1R inner reverse primer
SUMMARY OF THE INVENTION
Briefly stated, the present invention provides polypeptides, polynucleotides and methods for using such polypeptides and polynucleotides to identify therapeutic agents for treating conditions associated with MCH receptor activation. In one aspect, the present invention provides isolated MCH1R polypeptides that comprise a monkey MCH1R sequence. Within certain embodiments, such polypeptides comprise at least 30 consecutive amino acids of the cynomolgus macaque (Macaca fascicularis) MCH1R sequence provided in SEQ ID NO:56; preferably, the 30 consecutive amino acids are located within residues 1 130 of SEQ ID NO:56. Preferably, such polypeptides exhibit MCH1R ligand binding activity. Certain polypeptides comprise at least amino acids 30 60 of the cynomolgus macaque sequence provided in SEQ ID NO:2.
Within related aspects, the present invention provides MCH1R chimeric polypeptides that comprise a MCH1R sequence, wherein one or more domains are replaced with a corresponding domain of a different G protein-coupled receptor. Preferably, from 1 to 3 domains are replaced; more preferably 1 domain is replaced. For example, the intracellular loop 3, N-terminal domain or C-terminal domain of MCH1R may be replaced with a corresponding domain of MCH2R, NPY.sub.1 receptor, beta-2-adrenergic receptor or MCH1R from another species. Representative chimeric polypeptides include those provided in SEQ ID NOs:18, 20, 28, 42, 44, 46, 48, 50 and 52.
Within further aspects, the present invention provides isolated polynucleotides (e.g., DNA or RNA) that encode a MCH1R polypeptide or chimeric polypeptide as described above. Such polynucleotides may comprise a native sequence (e.g., SEQ ID NO:1 or 55) or may contain changes relative to the native sequence that do not affect the sequence of the encoded polypeptide. Certain such polynucleotides comprise at least 90 consecutive nucleotides of SEQ ID NO:55.
The present invention further provides, within related aspects, expression vectors (e.g., plasmids and viral vectors) that comprise a polynucleotide as described above, as well as transgenic host cells (i.e., cells comprising at least one heterologous expression vector) that express a polypeptide as described above (e.g., as a result of being transformed or transfected with at least one such expression vector) and cell membrane preparations isolated from such transgenic cells.
Methods are further provided, within other aspects, for determining MCH receptor binding activity of a compound, comprising the steps of: (a) contacting a compound with at least one transgenic cell or with a cell membrane preparation as described above; and (b) detecting binding of the compound to the cell(s) or cell membrane preparation. Binding may be detected, for example, by measuring competition for binding with detectably labeled MCH.
Within further aspects, the present invention provides methods for detecting MCH receptor modulating activity of a compound, comprising the steps of: (a) contacting a compound with at least one transgenic cell as described above; (b) detecting a cellular property (e.g., a level of Ca.sup.2+ in the contacted cell(s)); and (c) comparing the detected cellular property with a property detected in control cells in the absence of compound (e.g., comparing a detected level of Ca.sup.2+ with a level of Ca.sup.2+ detected in control cells in the absence of compound). Within certain embodiments, before step (a), the transgenic cells are: (i) contacted with an indicator of intracellular Ca.sup.2+ concentration to yield indicator-loaded cells; and (ii) washed. The level of Ca.sup.2+ may be detected, for example, by quantifying Ca.sup.2+-concentration-dependant changes in the properties of the indicator of intracellular Ca.sup.2+.
Methods are further provided, within other aspects, for detecting MCH receptor agonist activity of a compound, comprising the steps of: (a) contacting transgenic cells as described above with an indicator of intracellular Ca.sup.2+ concentration, to yield indicator-loaded cells; (b) washing the indicator-loaded cells; (c) contacting a portion of the washed, indicator-loaded cells with a compound to yield test cells; (d) separately detecting a property of the indicator of intracellular Ca.sup.2+ concentration in the test cells and in a second portion of the washed and indicator-loaded cells; and (e) comparing the detected property of the test cells with the detected property of the washed indicator-loaded cells.
The present invention further provides methods for detecting MCH receptor antagonist activity of a compound, comprising the steps of: (a) contacting a compound and an MCH receptor agonist with transgenic cells as described above; (b) detecting a level of Ca.sup.2+0 in the contacted cells; and (c) comparing the detected level of Ca.sup.2+ with a level of Ca.sup.2+ detected in control cells in the presence of agonist and in the absence of compound.
Methods are further provided for detecting MCH receptor antagonist activity of a compound, comprising the steps of: (a) contacting transgenic cells as described above with an indicator of intracellular Ca.sup.2+ concentration, to yield indicator-loaded cells; (b) washing the indicator-loaded cells; (c) contacting a first portion of the washed, indicator-loaded cells with a compound and an MCH receptor agonist to yield test cells; (d) contacting a second portion of the washed, indicator-loaded cells with an MCH receptor agonist to yield control cells; (e) separately detecting a property of the indicator of intracellular Ca.sup.2+ in the test cells and in the control cells; and (f) comparing the detected property of the test cells with the detected property of the control cells.
These and other aspects of the present invention will become apparent upon reference to the following detailed description and attached drawing.
DETAILED DESCRIPTION OF THE INVENTION
As noted above, the present invention is generally directed to compounds and methods for identifying therapeutic agents that may be used to treat conditions associated with MCH receptor activation. Compounds provided herein include polypeptides that comprise a monkey MCH1R sequence, as well as polynucleotides that encode such polypeptides. Chimeric polypeptides comprising a MCH1R sequence in which one or more domains are replaced with a corresponding domain of another G protein-coupled receptor are also provided. MCH1R polypeptides and polynucleotides may be used to identify therapeutic agents, as discussed in further detail below.
MCH Receptor Polynucleotides
Any polynucleotide that encodes an MCH1R polypeptide or chimera as described herein is encompassed by the present invention. Polynucleotides may be single-stranded (coding or antisense) or double-stranded, and may be DNA (e.g., genomic, cDNA or synthetic) or RNA, such as mRNA molecules. Modified analogues of such polynucleotides are also encompassed (e.g., phosphorthioate derivatives). Additional coding or non-coding sequences may, but need not, be present within a polynucleotide of the present invention, and a polynucleotide may, but need not, be linked to other molecules and/or support materials.
Certain polynucleotides encode a cynomolgus macaque MCH1R polypeptide. Such polynucleotides generally encode at least 30 consecutive amino acid residues of the MCH1R sequence provided in SEQ ID NO:56. Preferably, at least 30 consecutive amino acids located between residues 1 and 130 are encoded by such polynucleotides, and the encoded polypeptide exhibits MCH1R ligand binding activity (i.e., detectably bind MCH within the assay provided in Example 4). Certain polynucleotides encode at least amino acid residues 30 60 (SEQ ID NO:30) of a cynomolgus macaque MCH1R protein sequence provided in SEQ ID NO:2. For less than full length MCH1R sequences, deletions at the 3' end are generally preferred. Preferred cynomolgus macaque MCH1R polynucleotides encode at least amino acid residues 2 64 of SEQ ID NO:2, more preferably at least amino acid residues 2 to 230 of SEQ ID NO:2 and still more preferably at least amino acid residues 2 to 353 of SEQ ID NO:2. Certain such polynucleotides comprise at least 90 consecutive nucleotides, preferably at least nucleotides 28 220, of a cynomolgus macaque MCH1R sequence provided herein (SEQ ID NO:1).
Cynomolgus macaque MCH1R polynucleotides may, but need not, further encode the 5' sequence provided in SEQ ID NO:54 (by comprising, for example, the 5' sequence recited in SEQ ID NO:53). The 5' sequence is also shown as residues 1 to 69 of SEQ ID NO:56 (encoded by nucleotides 1 to 207 of SEQ ID NO:55). Polynucleotides with this 5' sequence are referred to herein as MCH1R long form polynucleotides.
The present invention also provides polynucleotides that encode chimeric MCH1R polypeptides. Such chimeric polypeptides generally comprise a MCH1R sequence (e.g., monkey, as described herein, or human, as in SEQ ID NO:6) in which one or more domains have been replaced with a corresponding domain of a different G-coupled protein receptor (e.g., MCH1R from a different species; a different MCH receptor such as MCH2R; NPY1 receptor; or beta-2-adrenergic receptor). Certain such chimeric polypeptides are MCH1R intracellular loop 3 chimeras (i.e., MCH1R sequences in which the amino acid sequence of the third intracellular loop has been replaced by the amino acid sequence of the third intracellular loop of another G protein-coupled receptor), C-terminal chimeras or N-terminal chimeras. As noted above, polynucleotides encoding such chimeras may comprise naturally occurring and/or non-naturally occurring sequences.
Naturally-occurring sequences that may be used to construct chimeric polynucleotides are provided herein and in the literature (e.g., SEQ ID NO:9 and GenBank Accession Number M88461 for human NPY1 receptor sequence; SEQ ID NO:23 and Accession Number Y00106 for human beta-2 adrenergic receptor; SEQ ID NO:33, 35 or 37 for macaque MCH2R; SEQ ID NO:38 for canine MCH2R). A precise coding sequence suitable for the construction of a chimera is readily determined by those of ordinary skill in the art from the nucleotide and amino acid sequences provided herein, and may be constructed using standard recombinant techniques.
Polynucleotides complementary to the MCH1R sequences discussed above (or portions thereof) are also encompassed by the present invention. Such polynucleotides include, for example, PCR products and restriction fragments, and may find use as probes or primers. Probes may be labeled with a variety of reporter groups, such as radionuclides and enzymes. Complementary polynucleotides generally hybridize to a MCH1R polynucleotide under stringent conditions. Stringent conditions include, for example, hybridization to filter-bound DNA in 0.5 M NaHPO.sub.4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65.degree. C., and washing in 0.1.times.SSC/0.1% SDS at 68.degree. C.). For short oligonucleotide probes, washing may be performed in 6.times.SSC/0.05% sodium pyrophosphate at 37.degree. C. (for 14-base oligos), 48.degree. C. (for 17-base oligos), 55.degree. C. (for 20-base oligos), and 60.degree. C. (for 23-base oligos). Other stringent conditions include overnight hybridization at 42.degree. C. in a solution comprising: 50% formamide, 5.times.SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5.times.Denhardt's solution, 10% dextran sulfate, and 20 .mu.g/mL denatured, sheared salmon sperm DNA, followed by washing the filters in 0.times.SSC at about 65.degree. C.
It will be appreciated by those of ordinary skill in the art that, as a result of the degeneracy of the genetic code, there are many nucleotide sequences that encode the polypeptides provided herein. Some of these polynucleotides bear minimal homology to the nucleotide sequence of any naturally occurring gene. Nonetheless, polynucleotides that vary due to differences in codon usage are specifically contemplated by the present invention. Additionally, it will be apparent that sequence changes may be made in the non-coding regions of the polynucleotides without altering the amino acid sequence of the protein product.
The present invention also encompasses polynucleotides that encode amino acid sequences with up to 15 (preferably no more than 10, more preferably no more than 5) amino acid substitutions relative to a naturally occurring monkey MCH1R sequence, provided that any substitutions do not substantially diminish receptor function (e.g., determined using a calcium mobilization assay as described within Example 5 herein) and are non-human (i.e., do not result in a human MCH1R sequence (SEQ ID NO:6)). In general, as discussed below, conservative substitutions are preferred. MCH1R polynucleotides preferably encode a polypeptide that does not comprise one or more of the following residues: (1) Ala in the position corresponding to position 14 of SEQ ID NO:2; (2) Thr in the position corresponding to position 33 of SEQ ID NO:2; (3) Ile in the position corresponding to position 36 of SEQ ID NO:2; and/or (4) Thr in the position corresponding to position 60 of SEQ ID NO:2. More preferably, an MCH1R polynucleotide encodes a polypeptide having at least one, preferably at least three or four, of the following residues (or conservative substitutions thereof): (1) Thr in the position corresponding to position 14 of SEQ ID NO:2; (2) Ser in the position corresponding to position 33 of SEQ ID NO:2; (3) Val in the position corresponding to position 36 of SEQ ID NO:2; and/or (4) Met in the position corresponding to position 60 of SEQ ID NO:2. The phrase "in the position corresponding to," as used herein, refers to the position within the polypeptide that, when aligned with SEQ ID NO:2 (using, for example, a ClustalW alignment) is matched with the specified residue of SEQ ID NO:2.
Polynucleotides provided herein may further comprise additional sequences. For example, an optimized translation initiation sequence (Kozak sequence) may be added to the 5' terminus. In-frame additions of sequences encoding antibody recognition sites may also, or alternatively, be included. Such sites are well known in the art, and include, but are not limited to the His-6.times.(hexa-histidine) epitope (SEQ ID NO:3) which is specifically bound by the Monoclonal Anti-polyhistidine Clone HIS-1 monoclonal antibody (Sigma, St. Louis No. H1029), and the FLAG epitope (SEQ ID NO:4) which is specifically bound by the FLAG-M2 monoclonal antibody (Sigma, St. Louis No. F3165). Techniques for making such modifications are also well known in the art, and may be readily carried out using routine methods or by using prepared kits, such as the Sigma Mammalian FLAG Expression Kits (Sigma, St. Louis; e.g., Nos. FL-MA and FL-MC). Preferably, fusions are made as in-frame amino-(N-) or carboxy-(C-) terminal fusions. When properly membrane-inserted fusion proteins (e.g., proteins retaining receptor signal transduction function) are desired, C-terminal fusions are preferred as being less prone to interfere with membrane insertion of the fusion protein.
Polynucleotides are preferably "isolated" (i.e., represent at least 10% of total nucleic acid molecules, preferably at least 20% and more preferably at least 50% of total nucleic acid molecules, within a sample or preparation). Unless otherwise specified, a polynucleotide comprising a given sequence may be of any length.
Polynucleotides may be prepared using any of a variety of well known techniques. For example, polynucleotides (or portions thereof) may be amplified via polymerase chain reaction (PCR), using sequence-specific primers designed based on the sequences provided herein, which may be purchased or synthesized. Portions of a desired polynucleotide obtained using PCR may be assembled into a single contiguous sequence by ligating suitable fragments, using well known techniques. Alternatively, amplified portion may be used to isolate a full length gene from a suitable library (e.g., one or more brain regions such as hypothalamus) using well known hybridization techniques. Within such techniques, a library (cDNA or genomic) is screened using one or more polynucleotide probes or primers corresponding to a portion of the desired sequence. Preferably, a library is size-selected for larger molecules. Random primed libraries may also be preferred for obtaining 5' regions of genes.
It will be apparent that primers designed based on the sequences provided herein may be used to obtain polynucleotides encoding MCH1R from other species, and that such polynucleotides are within the scope of the present invention.
RNA molecules may be generated by in vitro or in vivo transcription of DNA sequences encoding an MCH1R polypeptide, provided that the DNA is incorporated into a vector with a suitable RNA polymerase promoter (such as T7 or SP6). For example, antisense RNA may be generated from suitable cDNA constructs that have been introduced into cells or tissues to facilitate the production of antisense RNA.
Polynucleotides containing nucleotide substitutions, additions and deletions may generally be prepared by any method known in the art, including chemical synthesis by, for example, solid phase phosphoramidite chemical synthesis. Modifications in a polynucleotide sequence may also be introduced using standard mutagenesis techniques, such as oligonucleotide-directed site-specific mutagenesis.
Nucleotide sequences as described herein may be joined to a variety of other nucleotide sequences using established recombinant DNA techniques. For example, a polynucleotide may be cloned into any of a variety of cloning vectors, including plasmids, phagemids, lambda phage derivatives and cosmids. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors and sequencing vectors. In general, a vector will contain an origin of replication functional in at least one organism, convenient restriction endonuclease sites and one or more selectable markers. Other elements will depend upon the desired use, and will be apparent to those of ordinary skill in the art.
MCH Receptor Polypeptides
The term "MCH1R polypeptide," as used herein, refers to monkey MCH1R polypeptides (i.e., polypeptides comprising a naturally-occurring monkey MCH1R sequence or variant thereof containing amino acid insertions, deletions and/or substitutions as described herein), as well as MCH1R chimeric polypeptides comprising an MCH1R sequence from any species in which one or more domains are replaced with corresponding domain(s) from a different G-coupled protein receptor. Cynomolgus macaque MCH1R polypeptides provided herein generally comprise at least 30 consecutive amino acid residues of SEQ ID NO:56, preferably at least 30 consecutive amino acids present between amino acids 1 and 130 of SEQ ID NO:56. Preferred MCH1R polypeptides comprise at least amino acid residues 30 60 (SEQ ID NO:30), 2 64 or 2 to 230 of SEQ ID NO:2. Certain such polypeptides comprise at least amino acid residues 2 to 353 of SEQ ID NO:2. MCH1R long form polypeptides may further comprise the N-terminal sequence shown in SEQ ID NO:54 (and as amino acids 1 69 of SEQ ID NO:56, which provides the full long form MCH1R sequence). Unless otherwise specified, a polypeptide comprising a given sequence may be of any length.
MCH1R polypeptides are preferably isolated. A polypeptide is said to be "isolated" if it represents at least 1% of total polypeptide molecules, preferably at least 10% and more preferably at least 20% of total polypeptide molecules, within a sample or preparation).
Certain MCH1R polypeptides and chimeric polypeptides exhibit MCH binding activity and/or receptor function. In other words, such polypeptides detectably bind MCH within a MCH1R ligand binding assay (i.e., within the assay provided in Example 4) and/or display detectable activity within a calcium mobilization assay as provided in Example 5. References herein to "MCH1R ligand binding activity" refer to binding detected within the assay described in Example 4.
As noted above, amino acid substitutions may be made within cynomolgus macaque MCH1R sequences at up to 15 amino acid residues, preferably at no more than 10 residues and more preferably at no more than 5 residues. Any substitutions should not substantially diminish MCH1R ligand binding activity and/or MCH receptor function. A substitution does not "substantially diminish" binding activity or receptor function if the activity within a ligand binding assay or calcium mobilization assay is enhanced, unchanged or diminished by no more than 10%, relative to the native MCH1R sequence of SEQ ID NO:2. In addition, substitutions should not result in a human MCH1R sequence (SEQ ID NO:6). Preferably, MCH1R polypeptides retain at least one, preferably all four, of the following amino acid residues: (1) Thr in the position corresponding to position 14 of SEQ ID NO:2; (2) Ser in the position corresponding to position 33 of SEQ ID NO:2; (3) Val in the position corresponding to position 36 of SEQ ID NO:2; and/or (4) Met in the position corresponding to position 60 of SEQ ID NO:2.
In general, conservative substitutions are preferred. A "conservative substitution" is one in which an amino acid is substituted for another amino acid that has similar properties, such that one skilled in the art of peptide chemistry would expect the secondary structure and hydropathic nature of the polypeptide to be substantially unchanged. Amino acid substitutions may generally be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the residues. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lys and arg; and amino acids with uncharged polar head groups having similar hydrophilicity values include leu, ile and val; gly and ala; asn and gln; and ser, thr, phe and tyr. Other groups of amino acids that may represent conservative changes include: (1) glu, asp, gin, asn, ser, thr; (2) cys, ser, tyr, thr; (3) gly, pro, val, ile, leu, met, ala, phe; (4) lys, arg, his; and (5) phe, tyr, trp, his.
Chimeric MCH1R polypeptides are those in which at least one domain is derived from a MCH1R sequence (e.g., monkey, human or rat), with one or more domains replaced with corresponding domain(s) from a different G-coupled protein receptor. As noted above, MCH receptors contain an N terminal domain, seven transmembrane domains interspersed with three intracellular loop domains alternating with three extracellular loop domains, and an intracellular C-terminal domain. The precise locations of domains may be conveniently calculated by computer analysis of hydrophobicity or hydrophilicity using hydropathy profiles, such as standard Kyte-Doolittle analysis (Kyte and Doolittle, J. Mol. Biol. 157:105 32, 1982). The transition boundaries between the hydrophobic and hydrophilic domains are typically marked by the presence of charged or polar (hydrophilic) amino acid residues at the beginning or end of a stretch of nonpolar (hydrophobic) residues. The N-terminus extends into the extracellular space and the C-terminus into the cytoplasm of the cell. Each of the seven hydrophobic domains is about 20 25 amino acids long, assumes a largely alpha helical conformation, and crosses once through the plasma membrane, its entire extent generally embedded in the membrane. The hydrophobic domains are thus also referred to as transmembrane domains or membrane-spanning alpha helical domains, while the hydrophilic domains are referred to as either extracellular or intracellular domains, depending upon their predicted locations in a functional, membrane-bound receptor. The hydrophilic domains interconnecting transmembrane domains form loops within the cytoplasm or extracellular space, and are consequently referred to as cytoplasmic or extracellular loop domains.
G protein-coupled receptors, including MCH receptors, have been structurally modeled as to secondary and tertiary structural conformation, and the precise locations of the extracellular, transmembrane and intracellular domains within their primary structures (i.e., their amino acid sequences) are well known and generally agreed to in the art. The location of domains within a G protein-coupled receptor may be determined using the model of Baldwin (EMBO J. 12:1693 703, 1993), in which certain conserved residues are initially located and aligned. For constructing chimeric polypeptides provided herein, locations of domains within the MCH1R polypeptide of SEQ ID NO:2 are generally as follows: extracellular N-terminal (residues 1 to 40), seven transmembrane domains (approximately residues 41 66, 76 101, 117 142, 158 183, 207 232, 254 279 and 291 316, respectively) interspersed with three intracellular loop domains alternating with three extracellular loop domains, and an intracellular C-terminal domain (residues 317 to end). Intracellular loop 3 consists of residues 233 253. Any of these domains may be replaced with a corresponding domain from MCH1R of a different species, MCH2R, or a non-MCH receptor such as NPY.sub.1 or beta-2 adrenergic receptor. It will be apparent that, when replacing one domain with another, the residue numbers provided above may be altered slightly in either direction in order to facilitate cloning. In general, residue numbers may be altered by up to 6, preferably up to 4, amino acid residues in either direction. For example, if intracellular loop 3 (IC3) is to be replaced, the replaced portion may begin at any residue between 227 and 239, and may end at any residue between 247 and 259. Preferred macaque MCH1R IC3 chimeras contain residues 1 232 and 254 353 of MCH1R, with residues corresponding to MCH1R 233 253 derived from a different G-coupled protein receptor. Similarly, the C-terminal domain may be replaced beginning at any residue between 311 and 323, preferably beginning at residue 319 320. Corresponding domains of other G-coupled protein receptors may be readily identified, as noted above, by performing an alignment of the receptor sequence with an MCH1R sequence provided herein. By way of example, the N-terminal domain, intracellular loop 3 and the C-terminal domain of macaque MCH2R may be amino acids 1 35, 222 248 and 312 340, respectively, of SEQ ID NO:34 or 36; intracellular loop 3 and the C-terminal domain of human NPY.sub.1 may be amino acids 236 260 and 329 384, respectively, of SEQ ID NO:10; and the C-terminal domain of human beta-2 adrenergic receptor may be amino acids 344 413 of SEQ ID NO:24.
Preferred chimeric polypeptides are those in which IC3, the C-terminal domain or the N-terminal domain is replaced. The sequences of certain representative chimeras are summarized in Table I and recited in SEQ ID NOs:18, 20, 28, 42, 44, 46, 48, 50 and 52. More specifically, SEQ ID NO:18 is a human MCH1R/human NPY.sub.1 receptor IC3 chimera in which the amino acid sequence of the third intracellular loop of the MCH receptor is replaced by the amino acid sequence of the third intracellular loop of the human NPY.sub.1 receptor (polynucleotide sequence provided in SEQ ID NO:17); SEQ ID NO:20 is a human MCH1R/human NPY.sub.1 receptor C-terminal chimera in which the C-terminal domain of the MCH receptor is replaced by the C-terminal domain of the human NPY.sub.1 receptor (polynucleotide sequence provided in SEQ ID NO:19); SEQ ID NO:28 is a human MCH1R/human beta-2 adrenergic receptor C-terminal chimera in which the C-terminal domain of the MCH receptor is replaced by the C-terminal domain of the human beta-2 adrenergic receptor (polynucleotide sequence provided in SEQ ID NO:27); SEQ ID NO:42 is a cynomolgus macaque MCH1R/human NPY.sub.1 receptor IC3 chimera (polynucleotide sequence provided in SEQ ID NO:41); SEQ ID NO:44 is a cynomolgus macaque MCH1R/human NPY.sub.1 C-terminal chimera (polynucleotide sequence provided in SEQ ID NO:43); SEQ ID NO:46 is a cynomolgus macaque MCH1R/human beta-2 adrenergic receptor C-terminal chimera (polynucleotide sequence provided in SEQ ID NO:45); SEQ ID NO:48 is a cynomolgus macaque MCH1R/cynomolgus macaque MCH2R N-terminal chimera, in which the N-terminal amino acid sequence of MCH1R is replaced by the N-terminal amino acid sequence of MCH2R (polynucleotide sequence provided in SEQ ID NO:47); SEQ ID NO:50 is a cynomolgus macaque MCH1R/cynomolgus macaque MCH2R IC3 chimera (polynucleotide sequence provided in SEQ ID NO:49); and SEQ ID NO:52 is a cynomolgus macaque MCH1R/cynomolgus macaque MCH2R C-terminal chimera (polynucleotide sequence provided in SEQ ID NO:51). It will be apparent that similar chimeras may be generated using the MCH1R long form shown in SEQ ID NO:56). As noted above, sequences that may be used to construct such chimeras are provided herein, and in the literature. Additional precise coding sequences suitable for the construction of a chimera may be readily determined by those of ordinary skill in the art from the amino acid sequences provided herein, and may be constructed using standard recombinant techniques.
TABLE-US-00001 TABLE I Representative MCH1R Chimeras SEQ ID MCH1R Residues Inserted Domain 18 1 232, 251 353 of Human NPY1 IC3 (aa SEQ ID NO:6 236 260 of SEQ ID NO:10) 20 1 319 of SEQ ID NO:6 Human NPY1 C-terminal (aa 329 384 of SEQ ID NO:10) 28 1 319 of SEQ ID NO:6 Human beta-2 adrenergic receptor C-terminal (aa 344 413 of SEQ ID NO:24) 42 1 232, 254 353 of Human NPY1 1C3 (aa 236 260 of SEQ ID NO:2 SEQ ID NO:10) 44 1 319 of SEQ ID NO:2 Human NPY1 C-terminal (aa 329 384 of SEQ ID NO:10) 46 1 318 of SEQ ID NO:2 Human beta-2 adrenergic receptor C-terminal (aa 344 413 of SEQ ID NO:24) 48 36 353 of SEQ ID NO:2 Macaque MCH2R N-terminal (aa 1 35 of SEQ ID NO:34 or 36) 50 1 232, 254 353 of Macaque MCH2R 1C3 (aa SEQ ID NO:2 222 248 of SEQ ID NO:34 or 36) 52 1 319 of SEQ ID NO:2 Macaque MCH2R C-terminal (aa 315 340 of SEQ ID NO: 34 or 36)
Polypeptides may be prepared using any of a variety of well known techniques from transgenic cells (i.e., cells that have been genetically altered to express a MCH1R polypeptide). Recombinant polypeptides encoded by polynucleotide sequences as described above may be readily prepared from the polynucleotide sequences using any of a variety of expression vectors known to those of ordinary skill in the art. Expression may be achieved in any appropriate host cell that has been transformed or transfected with at least one expression vector containing a DNA molecule that encodes a recombinant polypeptide. Suitable host cells include prokaryotes, yeast and higher eukaryotic cells, such as insect, mammalian or plant cells. Preferably, the host cells employed are E. coli, yeast, amphibian oocytes or a mammalian cell line such as COS, CHO, BHK, HEK 293, VERO, HeLa, MDCK, W138 or NIH 3T3 cells. Insect cell systems infected with recombinant virus expression vectors (for example, baculovirus) comprising a MCH1R polynucleotide provided herein may also be employed. Alternatively, a transgenic cell may be isolated from a transgenic animal.
Within certain embodiments, a MCH1R polypeptide is present within a membrane preparation. Such preparations are generated from transgenic cells that express a MCH1R polypeptide, using any standard procedure. Briefly, transfected host cell pellets are homogenized and centrifuged (e.g., 10 minutes at 48,000.times.g). The supernatant is discarded and the pellet is resuspended and homogenized again to generate an isolated membrane preparation. A more detailed protocol is provided in Example 3 herein. Preferably, isolated membranes have a MCH binding activity that is at least 2-fold greater, preferably 10-fold greater and more preferably at least 20-fold greater than that exhibited by control membranes isolated from a control cell (e.g., an untransfected cell of the same cell line used to prepare the recombinant cell or a cell transfected with a control vector that does not encode an MCH1R polypeptide). Preferred membrane preparations contain at least 0.1 pmol, 1 pmol or 5 pmol of MCH receptor polypeptide per mg of total membrane protein.
As noted above, MCH1R polypeptides may comprise additional sequences, such as antibody recognition sequences, that are not naturally present within a G protein-coupled receptor. A tagged fusion protein may be purified using an antibody specific for the tag (e.g., by affinity chromatography). Such purification procedures will typically require detergent extraction, and may result in a decrease in signal transduction activity. Such purified proteins are useful as antigens for the preparation of receptor-specific antibodies, in which case the retention of receptor signal transduction function is typically of little consequence.
Chimeric proteins may be prepared using standard recombinant methods. Briefly, convenient restriction sites may be incorporated into a MCH1R polynucleotide using site-directed mutagenesis. This allows the removal of polynucleotide encoding a particular domain. The domain to be inserted may be synthesized, and ligated to the digested MCH1R polynucleotide. The resulting polynucleotide encodes the chimeric polypeptide, and may be expressed using standard techniques, and as described herein. A similar process may be used to generate polypeptides that comprise a single MCH1R domain inserted into a different G protein-coupled receptor.
Expression Systems
Expression systems that may be used in the practice of certain aspects of the present invention include, but are not limited to, (a) insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) comprising one or more polynucleotides provided herein and (b) mammalian cell systems (e.g., COS, CHO, BHK, HEK 293, VERO, HeLa, MDCK, WI38 and NIH 3T3 cells) harboring recombinant expression constructs comprising one or more polynucleotides provided herein.
An expression vector is a vector for recombinant expression of a MCH1R polypeptide, comprising a MCH1R polynucleotide operatively linked to the necessary nucleotide sequences for expression (e.g., a suitable promoter and, if necessary, a terminating signal). A promoter is a nucleotide sequence (typically located 5' to the MCH receptor polynucleotide) that directs the transcription of adjacently linked coding sequences. A terminating signal may be a stop codon to end translation and/or a transcription termination signal. Additional regulatory element(s) (e.g., enhancer elements) may also be present within an expression vector. Such a vector is preferably a plasmid or viral vector. Techniques for incorporating DNA into such vectors are well known to those of ordinary skill in the art.
Preferably, an expression vector further comprises a selectable marker, which confers resistance to a selection. This allows cells to stably integrate the vector into their chromosomes and grow to form foci, which in turn can be cloned and expanded into cell lines. A number of selection systems can be used. For example, the hypoxanthine-guanine phosphoribosyltransferase, adenine phosphoribosyltransferase and herpes simplex virus thymidine kinase genes can be employed in hgprt.sup.-, aprt.sup.- or tk.sup.-cells, respectively. Also, anti-metabolite resistance can be used as the basis of selection for genes such as: dhfr, which confers resistance to methotrexate; gpt, which confers resistance to mycophenolic acid; neo, which confers resistance to the aminoglycoside G-418); hygro, which confers resistance to hygromycin; and puro, which confers resistance to puromycin.
Mammalian vectors should contain promoters, preferably derived from the genome of mammalian cells (for example, a metallothionein actin or phosphoglycerate kinase promoter) or from mammalian viruses (for example, the adenovirus late promoter, a CMV promoter and the vaccinia virus 7.5K promoter). In adenoviral expression vectors, the MCH receptor polynucleotide may be ligated to an adenovirus transcription/translation control complex such as the late promoter and tripartite leader sequence. Specific initiation signals (e.g., the ATG initiation codon and adjacent sequences such as ribosome binding sites) may also be required for efficient translation of inserted nucleic acid molecules. The efficiency of expression may be further enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. The recombinant gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (for example, region E1 or E3) will result in a recombinant virus that is viable and capable of expressing a MCH receptor polypeptide in infected cells. A preferred mammalian expression vector is the PCDNA3.1 vector (INVITROGEN, Carlsbad, Calif.).
Another preferred expression system is an amphibian oocyte system in which MCH1R RNA is introduced into an oocyte. Preferably the amphibian is a frog, most preferably the African clawed frog, Xenopus laveis. A preferred expression vector for expression in amphibian oocytes is the PBLUESCRIPT SK.sup.- vector (STRATAGENE Cloning Systems, La Jolla, Calif.). Typically such vectors are used to generate MCH1R polypeptide-encoding RNAs in in vitro transcription systems, which RNAs are then injected into the oocytes to induce expression of the encoded protein.
An insect system utilizing a baculovirus such as Autographa californica nuclear polyhedrosis virus (AcNPV) can be used to express the MCH1R polypeptides provided herein. The virus grows in insect cells such as Spodoptera frugiperda cells. The coding sequence encoding the MCH1R polypeptide is typically inserted (e.g., ligated) into non-essential regions of the virus (for example into the polyhedrin gene) and placed under control of an AcNPV promoter (for example the polyhedrin promoter). Preferably, the successful introduction of the insert will result in inactivation of a viral gene. For example, when targeted into the polyhedrin gene, the successful incorporation of the insert will inactivate that gene and result in production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedrin gene). The resulting recombinant viruses are then used to infect insect cells, preferably Spodoptera frugiperda cells, in which the inserted coding sequence is expressed. A variety of kits for use in the preparation of an insect expression system are commercially available.
Host cells transformed or transfected with an expression vector comprising an MCH1R polynucleotide, and capable of expressing a MCH1R polypeptide, are further provided herein. Such cells may be prepared using standard transformation techniques. Stable expression is generally preferred, although transient expression systems may be suitable for certain uses. After the introduction of the vector (often following incubation in a non-selective medium to allow for recovery from the stress of vector introduction), engineered cells may be grown in a selective medium.
Assays
MCH1R polynucleotides and polypeptides may be used within a variety of assays to screen for and characterize compounds that modulate MCH receptor function. Such assays typically involve contacting a test compound with transfected host cells or isolated membranes prepared from such cells, and subsequently detecting (a) binding of the test compound to the cells or membranes (direct binding assays--e.g., via surface plasmon resonance, using a device available from BIAcor AB, Sweden); (b) an effect of the test compound on labeled ligand (e.g., radiolabeled MCH) binding to the cells or membranes (competitive binding assays); or (c) an effect on a cellular receptor response to MCH (functional assays). Test compounds may be any substance, but are preferably small organic, non-peptide molecules. Active compounds identified using such assays are useful, for example, as tools for receptor mapping and as pharmaceutical agents.
One suitable competitive binding assay is provided within Example 4. In such an assay, a test compound is used as a cold displacer. Briefly, a MCH1R polypeptide-containing membrane preparation (e.g., prepared from transfected HEK293 cells) is contacted (incubated) with labeled (e.g., .sup.125I) MCH and unlabeled test compound. Unbound MCH is then removed (e.g., by washing) and remaining bound label is detected. Incubation with a compound that detectably modulates MCH binding to MCH receptor will result in a decrease or increase in the amount of label bound to the MCH receptor preparation, relative to the amount of label bound in the absence of the compound. Preferably, such a compound will exhibit a K.sub.i at an MCH receptor of less than 1 micromolar, more preferably less than 500 nM, 100 nM, 20 nM or 10 nM, within a ligand binding assay performed as described in Example 4.
Functional assays use transfected host cells as substrates and measure cellular responses to contact with a test compound. Within such assays, a compound may act as an agonist, mediating a cell-based response when contacted with a cell-surface MCH receptor, or as an antagonist, inhibiting the response of cell-surface MCH receptor to an MCH receptor agonist (e.g., MCH). A representative functional assay is set forth below as Example 5. Within Ca.sup.2+ mobilization assays, MCH receptor modulating activity of a compound is detected by: (a) incubating (i.e., contacting) transgenic (e.g., transformed or transfected) cells with a compound; (b) detecting a level of Ca.sup.2+ in the contacted cells; and (c) comparing the detected level of calcium with a level of Ca.sup.2+ detected in control cells that are incubated in the absence of test compound. Preferably, within such assays, the transgenic cells are initially contacted with an indicator of intracellular Ca.sup.2+ concentration, such as Fluo-3 Calcium Sensitive Dye (Molecular Probes; Eugene, Oreg.) and then washed. The compound is then contacted with the washed cells, and the level of calcium is detected by quantifying Ca.sup.2+ concentration-dependant changes in the properties of the indicator of intracellular Ca.sup.2+. The level of calcium detected in the presence of test compound is preferably at least 2-fold greater than the level detected in the absence of test compound (i.e., in control cells that are contacted with the indicator of intracellular Ca.sup.2+ concentration, but not with the test compound).
MCH receptor antagonist activity may also be detected using calcium mobilization assays performed in the presence of a known MCH receptor agonist (e.g., MCH). MCH receptor agonist is preferably added to test and control cells just prior to detecting intracellular Ca.sup.2+ concentration. Preferably, the concentration of intracellular Ca.sup.2+ in the agonist-contacted test cell is significantly less (to the p.ltoreq.0.05 level, as measured using a parametric test of statistical significance) than the concentration of intracellular Ca.sup.2+ in the agonist-contacted control cell.
Compounds identified using such assays may be used for treating diseases and disorders associated with MCH receptor activation, such as eating disorders (e.g., obesity and bulimia nervosa), sexual disorders, diabetes, heart disease and stroke. Patients may include humans, companion animals (such as dogs) and livestock animals.
The following Examples are offered by way of illustration and not by way of limitation.
EXAMPLES
Example 1
MCH1R Polynucleotide Preparation
This Example illustrates the isolation of representative MCH1R polynucleotides.
A. Monkey MCH1R
RNA was isolated from Cynomolgus macaque hypothalamus using Trizol Reagent (Life Technologies, Gaithersburg, Md.). cDNA was prepared using random primers and Reverse Transcriptase (Life Technologies) according to the manufacturer's instructions.
Cynomolgus macaque MCH1R cDNA was obtained using PCR, with the following primers: 5' Forward Outer Primer GAGCAGGCGA CCGGCACTGG CTGG (SEQ ID NO:7) 3' Reverse Primer GGAGGTGTGC AGGGTGGCAG GGGAAGTA (SEQ ID NO:8)
PCR was performed using the Advantage-GC cDNA PCR Kit (Clontech Laboratories Palo Alto, Calif.) in 50 microliter reactions containing: 10 microliters GC Melt, 10 microliters 5.times. PCR reaction buffer, 1 microliter 50.times. dNTP Mix (10 mM each), 12.5 pmoles forward and reverse primers, 1 microliter Advantage-GC cDNA Polymerase Mix (50.times.), 1 microliter Cynomolgus macaque RT product. Conditions for touchdown PCR were as follows:
TABLE-US-00002 94.degree. C. - 3 minutes 20 cycles: 94.degree. C. - 30 seconds 60.degree. C. to 50.degree. C. in 0.5.degree. C. intervals for 20 rounds - 30 seconds 68.degree. C. - 60 seconds 20 cycles: 94.degree. C. - 30 seconds 50.degree. C. - 30 seconds 68.degree. C. - 60 seconds 4.degree. C.
The full length PCR product was initially cloned into the vector pGEM-T (Invitrogen, Carlsbad, Calif.). The cDNA was reamplified using a forward primer engineered to include an optimal translation initiation site (Kozak sequence). A cDNA expression cassette fragment encoding the monkey MCH1R was blunt end ligated into the PCR-SCRIPT vector (STRATAGENE, La Jolla, Calif.). The receptor sequence was excised from this vector using EcoRI and Not I and subcloned into the EcoRI/Not I site of PCDNA3.1 (INVITROGEN Corp.; Carlsbad, Calif.).
A receptor cDNA expression cassette thus cloned from cynomolgus macaque total hypothalamic cDNA (and referred to herein as cynMacMCH1R, SEQ ID NO:1) was subcloned into the PCDNA3.1 expression vector to create the MCH1 receptor expression vector, CynMacMCH1RDNA. This cynMacMCH1R cDNA expression cassette has been also been cloned into pCR-Script, and pBacPac9 vectors. The nucleotide and amino acid sequences of cynomolgus macaque MCH1R are shown in SEQ ID NO:1 and 2, respectively.
The MCH1R 5' extension was cloned using RACE. Cynomolgus macaque temporal cortex total RNA was used as a template and RACE was performed using the FirstChoice.TM. RLM-RACE kit (Ambion, Austin, Tex.) according to the manufacturer's instructions, with the outer reverse primer corresponding to nucleotides 503 478 of SEQ ID NO:1 (CACAGGAGGCAGATCACCAGGGTGGC; SEQ ID NO:57) and the inner reverse primer corresponding to nucleotides 393 372 of SEQ ID NO:1 (GGTGCTGGTGAACTGA CTATTG; SEQ ID NO:58). PCR conditions were as follows:
TABLE-US-00003 94.degree. C. - 3 minutes 35 cycles: 94.degree. C. - 30 seconds 58.degree. C. - 30 seconds 68.degree. C. - 30 seconds 68.degree. C. - 7 minutes 4.degree. C.
The sequence of the 5' region is shown in SEQ ID NO:53, with the encoded amino acid sequence in SEQ ID NO:54. The long form of MCH1R, which includes the 5' extension, is shown in SEQ ID NO:55 (DNA sequence) and SEQ ID NO:56 (amino acid sequence). Alignments of the monkey MCH1R sequences with other MCH1R sequences are shown in FIGS. 1 (A and B) and 2.
B. Human MCH1R/human NPY1 Receptor Intracellular Loop 3 Chimera
Human MCH1R (SEQ ID NO:5) was cloned as a PCR product from a Gibco Human Brain library (Life Technologies; Rockville, Md.) as described above using the following primers:
Forward 5'CCACCATGGACCTGGAAGCCTCG (SEQ ID NO:31)
Reverse 5'AGGGTGGCAGGGGAAGTATC (SEQ ID NO:32)
The human MCH1R cDNA (SEQ ID NO:5) was digested with BamH I (base 689 694) and BstE II (bases 759 765) to remove the IC3 domain. This corresponds to amino acids 230 255 in SEQ ID NO:6. The IC3 domain from the human NPY1 receptor cDNA (SEQ ID NO:9, bases 706 779 and corresponding to amino acids 236 260 of SEQ ID NO:10) was constructed from two complementary oligonucleotides (SEQ ID NO:14 and SEQ ID NO:15) which contain the BamH I and BstE II sites. The two oligonucleotides were heated to 95.degree. C., allowed to anneal, and are inserted into the digested MCH1R to yield the sequence the human MCH1R/human NPY1 receptor Intracellular Loop 3 chimera (SEQ ID NO:17). The corresponding amino acid sequence is given as SEQ ID NO:18. The entire sequence was subcloned into pcDNA 3.1 plus to yield SEQ ID NO:21.
C. Human MCH1R/human NPY 1 Receptor C-Terminal Chimera
To exchange the human NPY1 receptor C-terminal with that of the human MCH1R, a BspE I restriction site was introduced into both receptors. In the human MCH1R (SEQ ID NO:5) a silent C to G point mutation was made at base 957 to produce SEQ ID NO:16. For the human NPY1 receptor C-terminal, base 983 was mutated from A to G which results in a Q to R amino acid change at 328 of SEQ ID NO:10. A PCR fragment (SEQ ID NO:13) generated with SEQ ID NO:9 as a template using primers SEQ ID NO:11 and SEQ ID NO:12 (SEQ ID NO:12 is mainly comprised of vector sequence) was amplified. This PCR fragment was subcloned BspE I to Not I into the mutated human MCH1R (SEQ ID NO:16) to form the human MCH1R/human NPY1 receptor C-terminal chimera (SEQ ID NO:19). The corresponding amino acid sequence is given as SEQ ID NO:20. The final sequence in pcDNA 3.1 plus is given as SEQ ID NO:21.
D. Human MCH1R/human Beta Adrenergic Receptor C-terminal Chimera
The C-terminal sequence from the human beta-2 adrenergic receptor (SEQ ID NOs:23 and 24) was also used form a human MCH1R/beta adrenergic receptor C-terminal chimera. Primers (SEQ ID NOs:25 and 26) were used to amplify a PCR product from the human beta-2 adrenergic receptor (SEQ ID NO:23) which includes a BspE I site on the 5' end and an Xba I site on the 3' end. This fragment was introduced BspE I to Xba I into the human MCH1R mutated at base 957 as discussed above (SEQ ID NO:16) to form the Human MCH1R/human beta adrenergic receptor C-terminal chimera (SEQ ID NO:27). The corresponding amino acid sequence is given as SEQ ID NO:28. The final sequence in pcDNA 3.1 plus is given as SEQ ID NO:29.
It will be apparent that similar cloning procedures can be used to generate the corresponding chimeras based on the monkey MCH1R sequence and/or substituting domains from other G protein-coupled receptors.
Example 2
Preparation of Host Cells Expressing MCH1R Polypeptides
This Example illustrates the expression of representative MCH1R polynucleotides in host cells.
HEK 293 cells were stably transfected via standard calcium phosphate precipitation procedures with the CynMacDNA monkey MCH1 receptor expression vector described in Example 1.
For transient transfection, cells were grown to confluency at 37.degree. C., 5% CO.sub.2, for approximately 48 72 hours in DMEM high glucose culture medium (catalog #10 017-CV, MEDIATECH, Herndon, Va.) supplemented with 10% fetal bovine serum, 25 mM HEPES. Cells could then be used directly within assays. For stable expression, cells were grown under the conditions described above (with the addition of 500 .mu.g/ml G418) for 2 3 weeks. Single selected colonies were then chosen to generate a stable cell line.
CHO (Chinese Hamster Ovary) cells were also transfected via standard calcium phosphate precipitation procedures with the MCH1R expression vector. For transient transfection, cells were grown to confluency at 37.degree. C., 5% CO.sub.2, approximately 48 72 hours, in Ham's F12 culture medium (catalog #10-080-CV, MEDIATECH, Herndon, Va.) supplemented with 10% fetal bovine serum, 25 mM HEPES. Cells could then be used directly within assays. For stable expression, cells were grown under the conditions described above (with the addition of 500 .mu.g/ml G418) for 2 3 weeks. Single selected colonies were then chosen to generate a stable cell line.
Example 3
Preparation of Isolated Membranes
This Example illustrates the preparation of isolated membranes comprising MCH1R polypeptides, for use within a variety of binding and activity assays.
Transfected HEK 293 cell pellets stored frozen at -80.degree. C. are thawed by addition of wash buffer (25 mM Hepes with 1.0 mM CaCl.sub.2, 5.0 mM MgCl.sub.2, 120 mM NaCl, PH 7.4) and homogenized for 30 seconds using a BRINKMAN POLYTRON, setting 5. Cells are centrifuged for 10 minutes at 48,000.times.g. The supernatant is discarded and the pellet is resuspended in fresh wash buffer, and homogenized again. The protein concentration of the resulting membrane preparation is measured using the Bradford protein assay (Bio-Rad Laboratories, Hercules, Calif.). By this measure, a 1-liter culture of cells typically yields 50 75 mg of total membrane protein.
Example 4
MCH1R Ligand Binding Assays
This Example illustrates the use of MCH1R-containing membranes within binding assays to monitor the ability of cells expressing MCH receptors to bind MCH or to screen for MCH1R agonists and antagonists.
Purified membranes from HEK 293 cells expressing MCH1R are prepared as described above. The membrane homogenate is centrifuged as before and resuspended to a protein concentration of 333 .mu.g/ml in binding buffer (Wash buffer+0.1% BSA and 1.0 .mu.M final conc. phosphoramidon) for an assay volume of 50 .mu.g membrane protein/150 .mu.l binding buffer. Phosphoramidon is from SIGMA BIOCHEMICALS, St. Louis, Mo. (cat# R-7385).
Ligand binding assays are performed at room temperature by combining 150 .mu.l of MCH1R-containing membranes in binding buffer, prepared as described above, 50 .mu.l .sup.125I-Tyr MCH in binding buffer and 50 .mu.l binding buffer. .sup.125I-Tyr MCH (specific activity=2200 Ci/mMol) is purchased from NEN, Boston, Mass. (Cat # NEX 373) and is diluted in binding buffer to provide a final assay concentration of 30 pM.
Competition binding assays for screening test compounds are performed at room temperature in Falcon 96 well round bottom polypropylene plates. To each assay well is added 150 .mu.l of MCH1R-containing membranes in binding buffer, prepared as described above, 50 .mu.l .sup.125I-Tyr MCH in binding buffer, 50 .mu.l binding buffer and 2 .mu.l test compound in DMSO.
Non-specific binding is defined as the binding measured in the presence of 1 .mu.M unlabeled MCH. MCH is purchased from BACHEM U.S.A., King of Prussia, Pa. (cat # H-1482). To each assay well used to determine non-specific MCH binding is added: 150 .mu.l of MCH1R-containing membranes in binding buffer, 50 .mu.l .sup.125I-Tyr MCH in binding buffer, unlabeled MCH in 25 .mu.l binding buffer, and 25 .mu.l binding buffer.
Assay plates are incubated for 1 hour at room temperature. Membranes are harvested onto WALLAC glass fiber filters (PERKIN-ELMER, Gaithersburg, Md.) which are pre-soaked with 1.0% PEI (polyethyleneimine) for 2 hours prior to use. Filters are allowed to dry overnight then counted in a WALLAC 1205 BETA PLATE counter after addition of WALLAC BETA SCINT scintillation fluid.
For saturation binding the concentration of .sup.125I-Tyr MCH is varied from 7 1,000 pM. Typically 11 concentration points are collected per saturation binding curve. Equilibrium binding parameters are determined by fitting the allosteric Hill equation to the measured values with the aid of the computer program FitP.TM. (BIOSOFT, Ferguson, Mo.).
Example 5
MCH 1 R Calcium Mobilization Assay
This Example illustrates the use of MCH1R-expressing cells within functional assays to monitor the response of cells expressing MCH receptors to MCH or to screen for MCH1R agonists and antagonists.
CHO or HEK 293 cells stably transfected with an MCH1R receptor expression vector as described above are grown to a density of 30,000 cells/well in FALCON black-walled, clear-bottomed 96-well plates (#3904, BECTON-DICKINSON, Franklin Lakes, N.J.). Prior to running the assay the culture medium is emptied from the 96 well plates. Fluo-3 calcium sensitive dye (Molecular Probes, Eugene, Oreg.) is added to each well (dye solution: 1 mg FLUO-3 AM, 440 .mu.l DMSO and 440 .mu.l 20% pluronic acid in DMSO; diluted 8.8 .mu.l/ml with KRH; 50 .mu.l diluted solution added per well). Plates are covered with aluminum foil and incubated at 37.degree. C. for 1 2 hours. After the incubation the dye solution is emptied from the plates, cells are washed once in 100 .mu.l KRH buffer (0.05 mM KCl, 0.115 M NaCl, 9.6 mM NaH.sub.2PO.sub.4, 0.01 mM MgSO.sub.4, 1 mM probenecid (Sigma), 25 mM HEPES, pH 7.4) to remove excess dye; after washing 80 .mu.l KRH buffer is added to each well.
In order to measure the ability of a test compound to antagonize the response of cells expressing MCH1R to MCH, the EC.sub.50 of MCH is first determined. An additional 20 .mu.l of KRH buffer and 1 .mu.l DMSO is added to each well of cells, prepared as described immediately above. 100 .mu.l human MCH in KRH buffer is automatically transferred by a FLIPR.TM. plate reader (Molecular Devices, Sunnyvale, Calif.) to each well, and fluorescence response is monitored by excitation at 480 nM and emission at 530 nM. An 8-point concentration response curve, with final MCH concentrations of 1 nM to 3 .mu.M, is used to determine MCH EC.sub.50.
Test compounds are dissolved in DMSO, diluted in 20 .mu.l KRH buffer, and added to cells prepared as described above. The 96 well plates containing prepared cells and test compounds are incubated in the dark, at room temperature for 0.5 to 6 hours. It is important that the incubation not continue beyond 6 hours. Just prior to determining the fluorescence response, 100 .mu.l human MCH diluted in KRH buffer to 2.times.EC.sub.50 is automatically added by the FLIPR instrument to each well of the 96 well plate for a final sample volume of 200 .mu.l and a final MCH concentration of EC.sub.50. The final concentration of test compounds in the assay wells is between 1 .mu.M and 5 .mu.M. Typically cells exposed to one EC.sub.50 of MCH exhibit a fluorescence response of about 10,000 Relative Fluorescence Units. Antagonists of the MCH receptor exhibit a response that is significantly less than that of the control cells to the p.ltoreq.0.05 level, as measured using a parametric test of statistical significance. Typically, antagonists of the MCH receptor decrease the fluorescence response relative to control cells by about 20%, preferably by about 50%, and most preferably by at least 80% as compared to matched control.
>
58 DNA Macaca fascicularis cctgg aagcctcgct gctgcccact ggtcccaaca ccagcaacac ctctgatggc 6taacc tcacctcggc aggatcacct cctcgctcag ggagcgtctc ctacatcaac atcatgc cttcggtgtt cggcaccatc tgcctcctgg gcatcatcgg gaactccatg atcttcg cggtcgtgaa gaagtccaag ctgcactggt gcaacaatgt ccccgacatc 24catca acctctcggt ggtggatctc ctctttctcc tgggcatgcc cttcatgatc 3agctca tgggcaatgg ggtgtggcac tttggggaga ccatgtgcac cctcatcacg 36ggatg ccaatagtca gttcaccagc acctacatcc tgaccgccat ggccattgac 42cctgg ccaccgtcca ccccatctct tccacaaagt tccggaagcc ctctgtggcc 48ggtga tctgcctcct gtgggccctc tccttcatca gcatcacccc cgtgtggttg 54cagac tcatcccctt cccaggaggt gcagtgggct gcggcatccg cttgcccaac 6acactg acctttactg gttcaccctg taccagtttt tcctggcctt tgccctgccc 66ggtca tcacggccgc atacgtgagg atcctgcagc gcatgacgtc ctcagtggcc 72ctccc agcgcagcat ccggctgcgg acaaagaggg tgacccgcac agccatcgcc 78cctgg tcttctttgt gtgctgggca ccctactatg tgctacagct gacccagttg 84cagcc gcccgaccct cacctttgtc tacctgtaca atgcggccat cagcttgggc 9ccaaca gctgcctcaa cccctttgtg tacattgtgc tctgcgagac gttccgcaaa 96ggtcc tttcggtgaa gcctgcagcc caggggcagc ttcgcgctgt cagcaacgct gacggctg acgaggagag gacagaaagc aaaggtacct ga 353 PRT Macaca fascicularis 2 Met Asp Leu Glu Ala Ser Leu Leu Pro Thr Gly Pro Asn Thr Ser Asn Ser Asp Gly Pro Asp Asn Leu Thr Ser Ala Gly Ser Pro Pro Arg 2 Ser Gly Ser Val Ser Tyr Ile Asn Ile Ile Met Pro Ser Val Phe Gly 35 4r Ile Cys Leu Leu Gly Ile Ile Gly Asn Ser Met Val Ile Phe Ala 5 Val Val Lys Lys Ser Lys Leu His Trp Cys Asn Asn Val Pro Asp Ile 65 7 Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met 85 9o Phe Met Ile His Gln Leu Met Gly Asn Gly Val Trp His Phe Gly Thr Met Cys Thr Leu Ile Thr Ala Met Asp Ala Asn Ser Gln Phe Ser Thr Tyr Ile Leu Thr Ala Met Ala Ile Asp Arg Tyr Leu Ala Val His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe 2Leu Tyr Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile 222la Ala Tyr Val Arg Ile Leu Gln Arg Met Thr Ser Ser Val Ala 225 234la Ser Gln Arg Ser Ile Arg Leu Arg Thr Lys Arg Val Thr Arg 245 25hr Ala Ile Ala Ile Cys Leu Val Phe Phe Val Cys Trp Ala Pro Tyr 267al Leu Gln Leu Thr Gln Leu Ser Ile Ser Arg Pro Thr Leu Thr 275 28he Val Tyr Leu Tyr Asn Ala Ala Ile Ser Leu Gly Tyr Ala Asn Ser 29Leu Asn Pro Phe Val Tyr Ile Val Leu Cys Glu Thr Phe Arg Lys 33Arg Leu Val Leu Ser Val Lys Pro Ala Ala Gln Gly Gln Leu Arg Ala 325 33al Ser Asn Ala Gln Thr Ala Asp Glu Glu Arg Thr Glu Ser Lys Gly 345 6 PRT Artificial Sequence His 6x epitope 3 His His His His His His PRT Artificial Sequence FLAG epitope 4 Asp Tyr Lys Asp Asp Asp Asp Lys Homo sapiens 5 atggacctgg aagcctcgct gctgcccact ggtcccaatg ccagcaacac ctctgatggc 6taacc tcacttcggc aggatcacct cctcgcacgg ggagcatctc ctacatcaac atcatgc cttcggtgtt cggcaccatc tgcctcctgg gcatcatcgg gaactccacg atcttcg cggtcgtgaa gaagtccaag ctgcactggt gcaacaacgt ccccgacatc 24catca acctctcggt agtagatctc ctctttctcc tgggcatgcc cttcatgatc 3agctca tgggcaatgg ggtgtggcac tttggggaga ccatgtgcac cctcatcacg 36ggatg ccaatagtca gttcaccagc acctacatcc tgaccgccat ggccattgac 42cctgg ccactgtcca ccccatctct tccacgaagt tccggaagcc ctctgtggcc 48ggtga tctgcctcct gtgggccctc tccttcatca gcatcacccc tgtgtggctg 54cagac tcatcccctt cccaggaggt gcagtgggct gcggcatacg cctgcccaac 6acactg acctctactg gttcaccctg taccagtttt tcctggcctt tgccctgcct 66ggtca tcacagccgc atacgtgagg atcctgcagc gcatgacgtc ctcagtggcc 72ctccc agcgcagcat ccggctgcgg acaaagaggg tgacccgcac agccatcgcc 78tctgg tcttctttgt gtgctgggca ccctactatg tgctacagct gacccagttg 84cagcc gcccgaccct cacctttgtc tacttataca atgcggccat cagcttgggc 9ccaaca gctgcctcaa cccctttgtg tacatcgtgc tctgtgagac gttccgcaaa 96ggtcc tgtcggtgaa gcctgcagcc caggggcagc ttcgcgctgt cagcaacgct gacggctg acgaggagag gacagaaagc aaaggcacct ga 353 PRT homo sapiens 6 Met Asp Leu Glu Ala Ser Leu Leu Pro Thr Gly Pro Asn Ala Ser Asn Ser Asp Gly Pro Asp Asn Leu Thr Ser Ala Gly Ser Pro Pro Arg 2 Thr Gly Ser Ile Ser Tyr Ile Asn Ile Ile Met Pro Ser Val Phe Gly 35 4r Ile Cys Leu Leu Gly Ile Ile Gly Asn Ser Thr Val Ile Phe Ala 5 Val Val Lys Lys Ser Lys Leu His Trp Cys Asn Asn Val Pro Asp Ile 65 7 Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met 85 9o Phe Met Ile His Gln Leu Met Gly Asn Gly Val Trp His Phe Gly Thr Met Cys Thr Leu Ile Thr Ala Met Asp Ala Asn Ser Gln Phe Ser Thr Tyr Ile Leu Thr Ala Met Ala Ile Asp Arg Tyr Leu Ala Val His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe 2Leu Tyr Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile 222la Ala Tyr Val Arg Ile Leu Gln Arg Met Thr Ser Ser Val Ala 225 234la Ser Gln Arg Ser Ile Arg Leu Arg Thr Lys Arg Val Thr Arg 245 25hr Ala Ile Ala Ile Cys Leu Val Phe Phe Val Cys Trp Ala Pro Tyr 267al Leu Gln Leu Thr Gln Leu Ser Ile Ser Arg Pro Thr Leu Thr 275 28he Val Tyr Leu Tyr Asn Ala Ala Ile Ser Leu Gly Tyr Ala Asn Ser 29Leu Asn Pro Phe Val Tyr Ile Val Leu Cys Glu Thr Phe Arg Lys 33Arg Leu Val Leu Ser Val Lys Pro Ala Ala Gln Gly Gln Leu Arg Ala 325 33al Ser Asn Ala Gln Thr Ala Asp Glu Glu Arg Thr Glu Ser Lys Gly 345 24 DNA Artificial Sequence 5' macaque MCHer 7 gagcaggcga ccggcactgg ctgg 24 8 28 DNA Artificial Sequence 3' macaque MCHer 8 ggaggtgtgc agggtggcag gggaagta 28 9 A Homo sapiens 9 atgaattcaa cattattttc ccaggttgaa aatcattcag tccactctaa tttctcagag 6tgccc agcttctggc ttttgaaaat gatgattgtc atctgccctt ggccatgata accttag ctcttgctta tggagctgtg atcattcttg gtgtctctgg aaacctggcc atcataa tcatcttgaa acaaaaggag atgagaaatg ttaccaacat cctgattgtg 24ttcct tctcagactt gcttgttgcc atcatgtgtc tcccctttac atttgtctac 3taatgg accactgggt ctttggtgag gcgatgtgta agttgaatcc ttttgtgcaa 36ttcaa tcactgtgtc cattttctct ctggttctca ttgctgtgga acgacatcag 42aatca accctcgagg gtggagacca aataatagac atgcttatgt aggtattgct 48ttggg tccttgctgt ggcttcttct ttgcctttcc tgatctacca agtaatgact 54gccgt tccaaaatgt aacacttgat gcgtacaaag acaaatacgt gtgctttgat 6ttccat cggactctca taggttgtct tataccactc tcctcttggt gctgcagtat 66tccac tttgttttat atttatttgc tacttcaaga tatatatacg cctaaaaagg 72caaca tgatggacaa gatgagagac aataagtaca ggtccagtga aaccaaaaga 78tatca tgctgctctc cattgtggta gcatttgcag tctgctggct ccctcttacc 84taaca ctgtgtttga ttggaatcat cagatcattg ctacctgcaa ccacaatctg 9tcctgc tctgccacct cacagcaatg atatccactt gtgtcaaccc catattttat 96cctga acaaaaactt ccagagagac ttgcagttct tcttcaactt ttgtgatttc gtctcggg atgatgatta tgaaacaata gccatgtcca cgatgcacac agatgtttcc aacttctt tgaagcaagc aagcccagtc gcatttaaaa aaatcaacaa caatgatgat tgaaaaaa tctga 384 PRT homo sapiens Asn Ser Thr Leu Phe Ser Gln Val Glu Asn His Ser Val His Ser Phe Ser Glu Lys Asn Ala Gln Leu Leu Ala Phe Glu Asn Asp Asp 2 Cys His Leu Pro Leu Ala Met Ile Phe Thr Leu Ala Leu Ala Tyr Gly 35 4a Val Ile Ile Leu Gly Val Ser Gly Asn Leu Ala Leu Ile Ile Ile 5 Ile Leu Lys Gln Lys Glu Met Arg Asn Val Thr Asn Ile Leu Ile Val 65 7 Asn Leu Ser Phe Ser Asp Leu Leu Val Ala Ile Met Cys Leu Pro Phe 85 9r Phe Val Tyr Thr Leu Met Asp His Trp Val Phe Gly Glu Ala Met Lys Leu Asn Pro Phe Val Gln Cys Val Ser Ile Thr Val Ser Ile Ser Leu Val Leu Ile Ala Val Glu Arg His Gln Leu Ile Ile Asn Arg Gly Trp Arg Pro Asn Asn Arg His Ala Tyr Val Gly Ile Ala Val Ile Trp Val Leu Ala Val Ala Ser Ser Leu Pro Phe Leu Ile Tyr Val Met Thr Asp Glu Pro Phe Gln Asn Val Thr Leu Asp Ala Tyr Asp Lys Tyr Val Cys Phe Asp Gln Phe Pro Ser Asp Ser His Arg 2Ser Tyr Thr Thr Leu Leu Leu Val Leu Gln Tyr Phe Gly Pro Leu 222he Ile Phe Ile Cys Tyr Phe Lys Ile Tyr Ile Arg Leu Lys Arg 225 234sn Asn Met Met Asp Lys Met Arg Asp Asn Lys Tyr Arg Ser Ser 245 25lu Thr Lys Arg Ile Asn Ile Met Leu Leu Ser Ile Val Val Ala Phe 267al Cys Trp Leu Pro Leu Thr Ile Phe Asn Thr Val Phe Asp Trp 275 28sn His Gln Ile Ile Ala Thr Cys Asn His Asn Leu Leu Phe Leu Leu 29His Leu Thr Ala Met Ile Ser Thr Cys Val Asn Pro Ile Phe Tyr 33Gly Phe Leu Asn Lys Asn Phe Gln Arg Asp Leu Gln Phe Phe Phe Asn 325 33he Cys Asp Phe Arg Ser Arg Asp Asp Asp Tyr Glu Thr Ile Ala Met 345hr Met His Thr Asp Val Ser Lys Thr Ser Leu Lys Gln Ala Ser 355 36ro Val Ala Phe Lys Lys Ile Asn Asn Asn Asp Asp Asn Glu Lys Ile 378 DNA Artificial Sequence human NPYtor - BspE forward primer for C-terminal ttccgg agagacttgc agttc 25 NA Artificial Sequence human NPYtor - reverse primer for C-terminal cgcggc cgcaggctat aagtagtttc ag 32 DNA Homo sapiens gagaga cttgcagttc ttcttcaact tttgtgattt ccggtctcgg gatgatgatt 6acaat agccatgtcc acgatgcaca cagatgtttc caaaacttct ttgaagcaag gcccagt cgcatttaaa aaaatcaaca acaatgatga taatgaaaaa atctgaaact tatagcc tgcggccgc 82 DNA Artificial Sequence IC3 sense oligo ctgata cgcctaaaaa ggagaaacaa catgatggac aagatgagag acaataagta 6ccagt gaaaccaaaa gg 82 NA Artificial Sequence IC3 antisense oligo cccttt tggtttcact ggacctgtac ttattgtctc tcatcttgtc catcatgttg 6ccttt ttaggcgtat cag 83 DNA Artificial Sequence human MCH BspE site added for C-terminal chimera acctgg aagcctcgct gctgcccact ggtcccaatg ccagcaacac ctctgatggc 6taacc tcacttcggc aggatcacct cctcgcacgg ggagcatctc ctacatcaac atcatgc cttcggtgtt cggcaccatc tgcctcctgg gcatcatcgg gaactccacg atcttcg cggtcgtgaa gaagtccaag ctgcactggt gcaacaacgt ccccgacatc 24catca acctctcggt agtagatctc ctctttctcc tgggcatgcc cttcatgatc 3agctca tgggcaatgg ggtgtggcac tttggggaga ccatgtgcac cctcatcacg 36ggatg ccaatagtca gttcaccagc acctacatcc tgaccgccat ggccattgac 42cctgg ccactgtcca ccccatctct tccacgaagt tccggaagcc ctctgtggcc 48ggtga tctgcctcct gtgggccctc tccttcatca gcatcacccc tgtgtggctg 54cagac tcatcccctt cccaggaggt gcagtgggct gcggcatacg cctgcccaac 6acactg acctctactg gttcaccctg taccagtttt tcctggcctt tgccctgcct 66ggtca tcacagccgc atacgtgagg atcctgcagc gcatgacgtc ctcagtggcc 72ctccc agcgcagcat ccggctgcgg acaaagaggg tgacccgcac agccatcgcc 78tctgg tcttctttgt gtgctgggca ccctactatg tgctacagct gacccagttg 84cagcc gcccgaccct cacctttgtc tacttataca atgcggccat cagcttgggc 9ccaaca gctgcctcaa cccctttgtg tacatcgtgc tctgtgagac gttccggaaa 96ggtcc tgtcggtgaa gcctgcagcc caggggcagc ttcgcgctgt cagcaacgct gacggctg acgaggagag gacagaaagc aaaggcacct ga A Artificial Sequence human MCH IC3 chimera acctgg aagcctcgct gctgcccact ggtcccaatg ccagcaacac ctctgatggc 6taacc tcacttcggc aggatcacct cctcgcacgg ggagcatctc ctacatcaac atcatgc cttcggtgtt cggcaccatc tgcctcctgg gcatcatcgg gaactccacg atcttcg cggtcgtgaa gaagtccaag ctgcactggt gcaacaacgt ccccgacatc 24catca acctctcggt agtagatctc ctctttctcc tgggcatgcc cttcatgatc 3agctca tgggcaatgg ggtgtggcac tttggggaga ccatgtgcac cctcatcacg 36ggatg ccaatagtca gttcaccagc acctacatcc tgaccgccat ggccattgac 42cctgg ccactgtcca ccccatctct tccacgaagt tccggaagcc ctctgtggcc 48ggtga tctgcctcct gtgggccctc tccttcatca gcatcacccc tgtgtggctg 54cagac tcatcccctt cccaggaggt gcagtgggct gcggcatacg cctgcccaac 6acactg acctctactg gttcaccctg taccagtttt tcctggcctt tgccctgcct 66ggtca tcacagccgc atacgtgagg atcctgatac gcctaaaaag gagaaacaac 72ggaca agatgagaga caataagtac aggtccagtg aaaccaaaag ggtgacccgc 78catcg ccatctgtct ggtcttcttt gtgtgctggg caccctacta tgtgctacag 84ccagt tgtccatcag ccgcccgacc ctcacctttg tctacttata caatgcggcc 9gcttgg gctatgccaa cagctgcctc aacccctttg tgtacatcgt gctctgtgag 96ccgca aacgcttggt cctgtcggtg aagcctgcag cccaggggca gcttcgcgct cagcaacg ctcagacggc tgacgaggag aggacagaaa gcaaaggcac ctga 357 PRT Artificial Sequence human MCH IC3 chimera Asp Leu Glu Ala Ser Leu Leu Pro Thr Gly Pro Asn Ala Ser Asn Ser Asp Gly Pro Asp Asn Leu Thr Ser Ala Gly Ser Pro Pro Arg 2 Thr Gly Ser Ile Ser Tyr Ile Asn Ile Ile Met Pro Ser Val Phe Gly 35 4r Ile Cys Leu Leu Gly Ile Ile Gly Asn Ser Thr Val Ile Phe Ala 5 Val Val Lys Lys Ser Lys Leu His Trp Cys Asn Asn Val Pro Asp Ile 65 7 Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met 85 9o Phe Met Ile His Gln Leu Met Gly Asn Gly Val Trp His Phe Gly Thr Met Cys Thr Leu Ile Thr Ala Met Asp Ala Asn Ser Gln Phe Ser Thr Tyr Ile Leu Thr Ala Met Ala Ile Asp Arg Tyr Leu Ala Val His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe 2Leu Tyr
Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile 222la Ala Tyr Val Arg Ile Leu Ile Arg Leu Lys Arg Arg Asn Asn 225 234et Asp Lys Met Arg Asp Asn Lys Tyr Arg Ser Ser Glu Thr Lys 245 25rg Val Thr Arg Thr Ala Ile Ala Ile Cys Leu Val Phe Phe Val Cys 267la Pro Tyr Tyr Val Leu Gln Leu Thr Gln Leu Ser Ile Ser Arg 275 28ro Thr Leu Thr Phe Val Tyr Leu Tyr Asn Ala Ala Ile Ser Leu Gly 29Ala Asn Ser Cys Leu Asn Pro Phe Val Tyr Ile Val Leu Cys Glu 33Thr Phe Arg Lys Arg Leu Val Leu Ser Val Lys Pro Ala Ala Gln Gly 325 33ln Leu Arg Ala Val Ser Asn Ala Gln Thr Ala Asp Glu Glu Arg Thr 345er Lys Gly Thr 355 DNA Artificial Sequence human MCHn NPYminal chimera acctgg aagcctcgct gctgcccact ggtcccaatg ccagcaacac ctctgatggc 6taacc tcacttcggc aggatcacct cctcgcacgg ggagcatctc ctacatcaac atcatgc cttcggtgtt cggcaccatc tgcctcctgg gcatcatcgg gaactccacg atcttcg cggtcgtgaa gaagtccaag ctgcactggt gcaacaacgt ccccgacatc 24catca acctctcggt agtagatctc ctctttctcc tgggcatgcc cttcatgatc 3agctca tgggcaatgg ggtgtggcac tttggggaga ccatgtgcac cctcatcacg 36ggatg ccaatagtca gttcaccagc acctacatcc tgaccgccat ggccattgac 42cctgg ccactgtcca ccccatctct tccacgaagt tccggaagcc ctctgtggcc 48ggtga tctgcctcct gtgggccctc tccttcatca gcatcacccc tgtgtggctg 54cagac tcatcccctt cccaggaggt gcagtgggct gcggcatacg cctgcccaac 6acactg acctctactg gttcaccctg taccagtttt tcctggcctt tgccctgcct 66ggtca tcacagccgc atacgtgagg atcctgcagc gcatgacgtc ctcagtggcc 72ctccc agcgcagcat ccggctgcgg acaaagaggg tgacccgcac agccatcgcc 78tctgg tcttctttgt gtgctgggca ccctactatg tgctacagct gacccagttg 84cagcc gcccgaccct cacctttgtc tacttataca atgcggccat cagcttgggc 9ccaaca gctgcctcaa cccctttgtg tacatcgtgc tctgtgagac gttccggaga 96gcagt tcttcttcaa cttttgtgat ttccggtctc gggatgatga ttatgaaaca agccatgt ccacgatgca cacagatgtt tccaaaactt ctttgaagca agcaagccca cgcattta aaaaaatcaa caacaatgat gataatgaaa aaatctga 375 PRT Artificial Sequence human MCHn NPYminal chimera protein sequence 2sp Leu Glu Ala Ser Leu Leu Pro Thr Gly Pro Asn Ala Ser Asn Ser Asp Gly Pro Asp Asn Leu Thr Ser Ala Gly Ser Pro Pro Arg 2 Thr Gly Ser Ile Ser Tyr Ile Asn Ile Ile Met Pro Ser Val Phe Gly 35 4r Ile Cys Leu Leu Gly Ile Ile Gly Asn Ser Thr Val Ile Phe Ala 5 Val Val Lys Lys Ser Lys Leu His Trp Cys Asn Asn Val Pro Asp Ile 65 7 Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met 85 9o Phe Met Ile His Gln Leu Met Gly Asn Gly Val Trp His Phe Gly Thr Met Cys Thr Leu Ile Thr Ala Met Asp Ala Asn Ser Gln Phe Ser Thr Tyr Ile Leu Thr Ala Met Ala Ile Asp Arg Tyr Leu Ala Val His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe 2Leu Tyr Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile 222la Ala Tyr Val Arg Ile Leu Gln Arg Met Thr Ser Ser Val Ala 225 234la Ser Gln Arg Ser Ile Arg Leu Arg Thr Lys Arg Val Thr Arg 245 25hr Ala Ile Ala Ile Cys Leu Val Phe Phe Val Cys Trp Ala Pro Tyr 267al Leu Gln Leu Thr Gln Leu Ser Ile Ser Arg Pro Thr Leu Thr 275 28he Val Tyr Leu Tyr Asn Ala Ala Ile Ser Leu Gly Tyr Ala Asn Ser 29Leu Asn Pro Phe Val Tyr Ile Val Leu Cys Glu Thr Phe Arg Arg 33Asp Leu Gln Phe Phe Phe Asn Phe Cys Asp Phe Arg Ser Arg Asp Asp 325 33sp Tyr Glu Thr Ile Ala Met Ser Thr Met His Thr Asp Val Ser Lys 345er Leu Lys Gln Ala Ser Pro Val Ala Phe Lys Lys Ile Asn Asn 355 36sn Asp Asp Asn Glu Lys Ile 37DNA Artificial Sequence human MCHn NPYhimera in pcDNA3.pN gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg 6tagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg gcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc gggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 24ttgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 3gttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 36ccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 42cgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt 48atgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 54cagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 6tattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 66cgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 72caacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 78cgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 84tactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 9aaactt aagcttggta ccgagctcgg atccgccccc accatggacc tggaagcctc 96tgccc actggtccca atgccagcaa cacctctgat ggccccgata acctcacttc caggatca cctcctcgca cggggagcat ctcctacatc aacatcatca tgccttcggt tcggcacc atctgcctcc tgggcatcat cgggaactcc acggtcatct tcgcggtcgt agaagtcc aagctgcact ggtgcaacaa cgtccccgac atcttcatca tcaacctctc tagtagat ctcctctttc tcctgggcat gcccttcatg atccaccagc tcatgggcaa gggtgtgg cactttgggg agaccatgtg caccctcatc acggccatgg atgccaatag agttcacc agcacctaca tcctgaccgc catggccatt gaccgctacc tggccactgt accccatc tcttccacga agttccggaa gccctctgtg gccaccctgg tgatctgcct tgtgggcc ctctccttca tcagcatcac ccctgtgtgg ctgtatgcca gactcatccc tcccagga ggtgcagtgg gctgcggcat acgcctgccc aacccagaca ctgacctcta ggttcacc ctgtaccagt ttttcctggc ctttgccctg ccttttgtgg tcatcacagc catacgtg aggatcctga tacgcctaaa aaggagaaac aacatgatgg acaagatgag acaataag tacaggtcca gtgaaaccaa aagggtgacc cgcacagcca tcgccatctg tggtcttc tttgtgtgct gggcacccta ctatgtgcta cagctgaccc agttgtccat gccgcccg accctcacct ttgtctactt atacaatgcg gccatcagct tgggctatgc acagctgc ctcaacccct ttgtgtacat cgtgctctgt gagacgttcc gcaaacgctt tcctgtcg gtgaagcctg cagcccaggg gcagcttcgc gctgtcagca acgctcagac ctgacgag gagaggacag aaagcaaagg cacctgatac ttcccctgcc accctgggct 2gcggccg ctcgagtcta gagggcccgt ttaaacccgc tgatcagcct cgactgtgcc 2tagttgc cagccatctg ttgtttgccc ctcccccgtg ccttccttga ccctggaagg 2cactccc actgtccttt cctaataaaa tgaggaaatt gcatcgcatt gtctgagtag 222attct attctggggg gtggggtggg gcaggacagc aagggggagg attgggaaga 228gcagg catgctgggg atgcggtggg ctctatggct tctgaggcgg aaagaaccag 234gctct agggggtatc cccacgcgcc ctgtagcggc gcattaagcg cggcgggtgt 24gttacg cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg ctcctttcgc 246tccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc taaatcgggg 252cttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa aacttgatta 258atggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt 264ccacg ttctttaata gtggactctt gttccaaact ggaacaacac tcaaccctat 27gtctat tcttttgatt tataagggat tttggggatt tcggcctatt ggttaaaaaa 276tgatt taacaaaaat ttaacgcgaa ttaattctgt ggaatgtgtg tcagttaggg 282aaagt ccccaggctc cccaggcagg cagaagtatg caaagcatgc atctcaatta 288caacc aggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat 294tcaat tagtcagcaa ccatagtccc gcccctaact ccgcccatcc cgcccctaac 3gcccagt tccgcccatt ctccgcccca tggctgacta atttttttta tttatgcaga 3cgaggcc gcctctgcct ctgagctatt ccagaagtag tgaggaggct tttttggagg 3aggcttt tgcaaaaagc tcccgggagc ttgtatatcc attttcggat ctgatcaaga 3aggatga ggatcgtttc gcatgattga acaagatgga ttgcacgcag gttctccggc 324gggtg gagaggctat tcggctatga ctgggcacaa cagacaatcg gctgctctga 33gccgtg ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca agaccgacct 336gtgcc ctgaatgaac tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac 342ttcct tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg actggctgct 348gcgaa gtgccggggc aggatctcct gtcatctcac cttgctcctg ccgagaaagt 354tcatg gctgatgcaa tgcggcggct gcatacgctt gatccggcta cctgcccatt 36caccaa gcgaaacatc gcatcgagcg agcacgtact cggatggaag ccggtcttgt 366aggat gatctggacg aagagcatca ggggctcgcg ccagccgaac tgttcgccag 372aggcg cgcatgcccg acggcgagga tctcgtcgtg acccatggcg atgcctgctt 378atatc atggtggaaa atggccgctt ttctggattc atcgactgtg gccggctggg 384cggac cgctatcagg acatagcgtt ggctacccgt gatattgctg aagagcttgg 39gaatgg gctgaccgct tcctcgtgct ttacggtatc gccgctcccg attcgcagcg 396ccttc tatcgccttc ttgacgagtt cttctgagcg ggactctggg gttcgaaatg 4gaccaag cgacgcccaa cctgccatca cgagatttcg attccaccgc cgccttctat 4aggttgg gcttcggaat cgttttccgg gacgccggct ggatgatcct ccagcgcggg 4ctcatgc tggagttctt cgcccacccc aacttgttta ttgcagctta taatggttac 42aaagca atagcatcac aaatttcaca aataaagcat ttttttcact gcattctagt 426tttgt ccaaactcat caatgtatct tatcatgtct gtataccgtc gacctctagc 432cttgg cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta tccgctcaca 438acaca acatacgagc cggaagcata aagtgtaaag cctggggtgc ctaatgagtg 444actca cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg 45agctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg tattgggcgc 456cgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta 462tcact caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag 468gtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg 474ccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg 48gaaacc cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg 486tcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga 492ggcgc tttctcaatg ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc 498gctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt 5tatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact 5aacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg 5aactacg gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt 522cggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt 528ttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct 534ctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg 54tgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt 546aatct aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt 552accta tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc 558gataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg 564cccac gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc 57gcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg 576tagag taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctaca 582cgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga 588gcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct 594cgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg 6aattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca 6aagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata 6gataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct 6gggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact 624accca actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa 63gaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc 636cttcc tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga 642atttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga 648gccac ctgacgtc 6498 22 6582 DNA Artificial Sequence human MCHn NPYminal chimera in pcDNA3.pN gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg 6tagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg gcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc gggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 24ttgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 3gttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 36ccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 42cgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt 48atgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 54cagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 6tattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 66cgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 72caacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 78cgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 84tactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 9aaactt aagcttggta ccgagctcgg atccactagt ccagtgtggt ggaattcctg 96cgggg gatccgcccc caccatggac ctggaagcct cgctgctgcc cactggtccc tgccagca acacctctga tggccccgat aacctcactt cggcaggatc acctcctcgc ggggagca tctcctacat caacatcatc atgccttcgg tgttcggcac catctgcctc gggcatca tcgggaactc cacggtcatc ttcgcggtcg tgaagaagtc caagctgcac gtgcaaca acgtccccga catcttcatc atcaacctct cggtagtaga tctcctcttt cctgggca tgcccttcat gatccaccag ctcatgggca atggggtgtg gcactttggg gaccatgt gcaccctcat cacggccatg gatgccaata gtcagttcac cagcacctac cctgaccg ccatggccat tgaccgctac ctggccactg tccaccccat ctcttccacg gttccgga agccctctgt ggccaccctg gtgatctgcc tcctgtgggc cctctccttc cagcatca cccctgtgtg gctgtatgcc agactcatcc ccttcccagg aggtgcagtg ctgcggca tacgcctgcc caacccagac actgacctct actggttcac cctgtaccag tttcctgg cctttgccct gccttttgtg gtcatcacag ccgcatacgt gaggatcctg gcgcatga cgtcctcagt ggcccccgcc tcccagcgca gcatccggct gcggacaaag ggtgaccc gcacagccat cgccatctgt ctggtcttct ttgtgtgctg ggcaccctac tgtgctac agctgaccca gttgtccatc agccgcccga ccctcacctt tgtctactta caatgcgg ccatcagctt gggctatgcc aacagctgcc tcaacccctt tgtgtacatc gctctgtg agacgttccg gagagacttg cagttcttct tcaacttttg tgatttccgg tcgggatg atgattatga aacaatagcc atgtccacga tgcacacaga tgtttccaaa 2tctttga agcaagcaag cccagtcgca tttaaaaaaa tcaacaacaa tgatgataat 2aaaatct gaaactactt atagcctgcg gccgctcgag tctagagggc ccgtttaaac 2ctgatca gcctcgactg tgccttctag ttgccagcca tctgttgttt gcccctcccc 222cttcc ttgaccctgg aaggtgccac tcccactgtc ctttcctaat aaaatgagga 228catcg cattgtctga gtaggtgtca ttctattctg gggggtgggg tggggcagga 234agggg gaggattggg aagacaatag caggcatgct ggggatgcgg tgggctctat 24tctgag gcggaaagaa ccagctgggg ctctaggggg tatccccacg cgccctgtag 246catta agcgcggcgg gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag 252tagcg cccgctcctt tcgctttctt cccttccttt ctcgccacgt tcgccggctt 258gtcaa gctctaaatc ggggcatccc tttagggttc cgatttagtg ctttacggca 264acccc aaaaaacttg attagggtga tggttcacgt agtgggccat cgccctgata 27gttttt cgccctttga cgttggagtc cacgttcttt aatagtggac tcttgttcca 276gaaca acactcaacc ctatctcggt ctattctttt gatttataag ggattttggg 282cggcc tattggttaa aaaatgagct gatttaacaa aaatttaacg cgaattaatt 288gaatg tgtgtcagtt agggtgtgga aagtccccag gctccccagg caggcagaag 294aaagc atgcatctca attagtcagc aaccaggtgt ggaaagtccc caggctcccc 3aggcaga agtatgcaaa gcatgcatct caattagtca gcaaccatag tcccgcccct 3tccgccc atcccgcccc taactccgcc cagttccgcc cattctccgc cccatggctg 3aattttt tttatttatg cagaggccga ggccgcctct gcctctgagc tattccagaa 3gtgagga ggcttttttg gaggcctagg cttttgcaaa aagctcccgg gagcttgtat 324ttttc ggatctgatc aagagacagg atgaggatcg tttcgcatga ttgaacaaga 33ttgcac gcaggttctc cggccgcttg ggtggagagg ctattcggct atgactgggc 336agaca atcggctgct ctgatgccgc cgtgttccgg ctgtcagcgc aggggcgccc 342ttttt gtcaagaccg acctgtccgg tgccctgaat gaactgcagg acgaggcagc 348tatcg tggctggcca cgacgggcgt tccttgcgca gctgtgctcg acgttgtcac 354cggga agggactggc tgctattggg cgaagtgccg gggcaggatc tcctgtcatc 36cttgct cctgccgaga aagtatccat catggctgat gcaatgcggc ggctgcatac 366atccg gctacctgcc cattcgacca ccaagcgaaa catcgcatcg agcgagcacg 372ggatg gaagccggtc ttgtcgatca ggatgatctg gacgaagagc atcaggggct 378cagcc gaactgttcg ccaggctcaa ggcgcgcatg cccgacggcg aggatctcgt
384cccat ggcgatgcct gcttgccgaa tatcatggtg gaaaatggcc gcttttctgg 39atcgac tgtggccggc tgggtgtggc ggaccgctat caggacatag cgttggctac 396atatt gctgaagagc ttggcggcga atgggctgac cgcttcctcg tgctttacgg 4cgccgct cccgattcgc agcgcatcgc cttctatcgc cttcttgacg agttcttctg 4gggactc tggggttcga aatgaccgac caagcgacgc ccaacctgcc atcacgagat 4gattcca ccgccgcctt ctatgaaagg ttgggcttcg gaatcgtttt ccgggacgcc 42ggatga tcctccagcg cggggatctc atgctggagt tcttcgccca ccccaacttg 426tgcag cttataatgg ttacaaataa agcaatagca tcacaaattt cacaaataaa 432ttttt cactgcattc tagttgtggt ttgtccaaac tcatcaatgt atcttatcat 438tatac cgtcgacctc tagctagagc ttggcgtaat catggtcata gctgtttcct 444aaatt gttatccgct cacaattcca cacaacatac gagccggaag cataaagtgt 45cctggg gtgcctaatg agtgagctaa ctcacattaa ttgcgttgcg ctcactgccc 456ccagt cgggaaacct gtcgtgccag ctgcattaat gaatcggcca acgcgcgggg 462cggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 468tcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca 474agggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 48aaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 486tcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 492ccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 498cgcct ttctcccttc gggaagcgtg gcgctttctc aatgctcacg ctgtaggtat 5agttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 5gaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 5tcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 522agagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt 528cgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 534aacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 54aaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 546ctcac gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc 552aaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct 558ttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca 564agttg cctgactccc cgtcgtgtag ataactacga tacgggaggg cttaccatct 57ccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca 576ccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc 582gtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg 588cgttg ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct 594cagct ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa 6gcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta 6ctcatgg ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc 6tctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg 6tgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag aactttaaaa 624catca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg 63ccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc 636cgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg 642acgga aatgttgaat actcatactc ttcctttttc aatattattg aagcatttat 648ttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa taaacaaata 654tccgc gcacatttcc ccgaaaagtg ccacctgacg tc 6582 23 23Homo sapiens 23 gaattcatgc cgcgtttctg tgttggacag gggtgacttt gtgccggatg gcttctgtgt 6cgcgc gcgagtgtgc atgtcggtga gctgggaggg tgtgtctcag tgtctatggc ggttcgg tataagtcta agcatgtctg ccagggtgta tttgtgcctg tatgtgcgtg cggtggg cactctcgtt tccttccgaa tgtggggcag tgccggtgtg ctgccctctg 24agacc tcaagccgcg caggcgccca gggcaggcag gtagcggcca cagaagagcc 3gctccc gggttggctg gtaagcacac cacctccagc tttagccctc tggggccagc 36tagcc gggaagcagt ggtggcccgc cctccaggga gcagttgggc cccgcccggg 42ctcag gagaaggagg gcgaggggag gggagggaaa ggggaggagt gcctcgcccc 48ggctg ccggcgtgcc attggccgaa agttcccgta cgtcacggcg agggcagttc 54aagtc ctgtgcacat aacgggcaga acgcactgcg aagcggcttc ttcagagcac 6tggaac tggcaggcac cgcgagcccc tagcacccga caagctgagt gtgcaggacg 66ccacc acacccacac cacagccgct gaatgaggct tccaggcgtc cgctcgcggc 72gagcc ccgccgtggg tccgcctgct gaggcgcccc cagccagtgc gcttacctgc 78tgcgc gccatggggc aacccgggaa cggcagcgcc ttcttgctgg cacccaatag 84atgcg ccggaccacg acgtcacgca gcaaagggac gaggtgtggg tggtgggcat 9atcgtc atgtctctca tcgtcctggc catcgtgttt ggcaatgtgc tggtcatcac 96ttgcc aagttcgagc gtctgcagac ggtcaccaac tacttcatca cttcactggc gtgctgat ctggtcatgg gcctggcagt ggtgcccttt ggggccgccc atattcttat aaatgtgg acttttggca acttctggtg cgagttttgg acttccattg atgtgctgtg tcacggcc agcattgaga ccctgtgcgt gatcgcagtg gatcgctact ttgccattac cacctttc aagtaccaga gcctgctgac caagaataag gcccgggtga tcattctgat tgtggatt gtgtcaggcc ttacctcctt cttgcccatt cagatgcact ggtaccgggc cccaccag gaagccatca actgctatgc caatgagacc tgctgtgact tcttcacgaa aagcctat gccattgcct cttccatcgt gtccttctac gttcccctgg tgatcatggt tcgtctac tccagggtct ttcaggaggc caaaaggcag ctccagaaga ttgacaaatc agggccgc ttccatgtcc agaaccttag ccaggtggag caggatgggc ggacggggca gactccgc agatcttcca agttctgctt gaaggagcac aaagccctca agacgttagg tcatcatg ggcactttca ccctctgctg gctgcccttc ttcatcgtta acattgtgca tgatccag gataacctca tccgtaagga agtttacatc ctcctaaatt ggataggcta tcaattct ggtttcaatc cccttatcta ctgccggagc ccagatttca ggattgcctt aggagctt ctgtgcctgc gcaggtcttc tttgaaggcc tatgggaatg gctactccag acggcaac acaggggagc agagtggata tcacgtggaa caggagaaag aaaataaact tgtgtgaa gacctcccag gcacggaaga ctttgtgggc catcaaggta ctgtgcctag ataacatt gattcacaag ggaggaattg tagtacaaat gactcactgc tgtaaagcag 2ttctact tttaaagacc ccccccccca acagaacact aaacagacta tttaacttga 2taataaa cttagaataa aattgtaaaa ttgtatagag atatgcagaa ggaagggcat 2tctgcct tttttatttt tttaagctgt aaaaagagag aaaacttatt tgagtgatta 222tattt gtacagttca gttcctcttt gcatggaatt tgtaagttta tgtctaaaga 228agtcc tagaggacct gagtc 23homo sapiens 24 Met Gly Gln Pro Gly Asn Gly Ser Ala Phe Leu Leu Ala Pro Asn Arg His Ala Pro Asp His Asp Val Thr Gln Gln Arg Asp Glu Val Trp 2 Val Val Gly Met Gly Ile Val Met Ser Leu Ile Val Leu Ala Ile Val 35 4e Gly Asn Val Leu Val Ile Thr Ala Ile Ala Lys Phe Glu Arg Leu 5 Gln Thr Val Thr Asn Tyr Phe Ile Thr Ser Leu Ala Cys Ala Asp Leu 65 7 Val Met Gly Leu Ala Val Val Pro Phe Gly Ala Ala His Ile Leu Met 85 9s Met Trp Thr Phe Gly Asn Phe Trp Cys Glu Phe Trp Thr Ser Ile Val Leu Cys Val Thr Ala Ser Ile Glu Thr Leu Cys Val Ile Ala Asp Arg Tyr Phe Ala Ile Thr Ser Pro Phe Lys Tyr Gln Ser Leu Thr Lys Asn Lys Ala Arg Val Ile Ile Leu Met Val Trp Ile Val Ser Gly Leu Thr Ser Phe Leu Pro Ile Gln Met His Trp Tyr Arg Ala His Gln Glu Ala Ile Asn Cys Tyr Ala Asn Glu Thr Cys Cys Asp Phe Thr Asn Gln Ala Tyr Ala Ile Ala Ser Ser Ile Val Ser Phe 2Val Pro Leu Val Ile Met Val Phe Val Tyr Ser Arg Val Phe Gln 222la Lys Arg Gln Leu Gln Lys Ile Asp Lys Ser Glu Gly Arg Phe 225 234al Gln Asn Leu Ser Gln Val Glu Gln Asp Gly Arg Thr Gly His 245 25ly Leu Arg Arg Ser Ser Lys Phe Cys Leu Lys Glu His Lys Ala Leu 267hr Leu Gly Ile Ile Met Gly Thr Phe Thr Leu Cys Trp Leu Pro 275 28he Phe Ile Val Asn Ile Val His Val Ile Gln Asp Asn Leu Ile Arg 29Glu Val Tyr Ile Leu Leu Asn Trp Ile Gly Tyr Val Asn Ser Gly 33Phe Asn Pro Leu Ile Tyr Cys Arg Ser Pro Asp Phe Arg Ile Ala Phe 325 33ln Glu Leu Leu Cys Leu Arg Arg Ser Ser Leu Lys Ala Tyr Gly Asn 345yr Ser Ser Asn Gly Asn Thr Gly Glu Gln Ser Gly Tyr His Val 355 36lu Gln Glu Lys Glu Asn Lys Leu Leu Cys Glu Asp Leu Pro Gly Thr 378sp Phe Val Gly His Gln Gly Thr Val Pro Ser Asp Asn Ile Asp 385 39Gln Gly Arg Asn Cys Ser Thr Asn Asp Ser Leu Leu 425 29 DNA Artificial Sequence human beta-2 adrenergic receptor forward primer 25 tgttccggag ttctttgaag gcctatggg 29 26 25 DNA Artificial Sequence human beta-2 adrenergic receptor reverse primer 26 gctctagagc ttacagcagt gagtc 25 27 A Artificial Sequence human MCHn beta-2 adrenergic receptor C-terminal chimera 27 atggacctgg aagcctcgct gctgcccact ggtcccaatg ccagcaacac ctctgatggc 6taacc tcacttcggc aggatcacct cctcgcacgg ggagcatctc ctacatcaac atcatgc cttcggtgtt cggcaccatc tgcctcctgg gcatcatcgg gaactccacg atcttcg cggtcgtgaa gaagtccaag ctgcactggt gcaacaacgt ccccgacatc 24catca acctctcggt agtagatctc ctctttctcc tgggcatgcc cttcatgatc 3agctca tgggcaatgg ggtgtggcac tttggggaga ccatgtgcac cctcatcacg 36ggatg ccaatagtca gttcaccagc acctacatcc tgaccgccat ggccattgac 42cctgg ccactgtcca ccccatctct tccacgaagt tccggaagcc ctctgtggcc 48ggtga tctgcctcct gtgggccctc tccttcatca gcatcacccc tgtgtggctg 54cagac tcatcccctt cccaggaggt gcagtgggct gcggcatacg cctgcccaac 6acactg acctctactg gttcaccctg taccagtttt tcctggcctt tgccctgcct 66ggtca tcacagccgc atacgtgagg atcctgcagc gcatgacgtc ctcagtggcc 72ctccc agcgcagcat ccggctgcgg acaaagaggg tgacccgcac agccatcgcc 78tctgg tcttctttgt gtgctgggca ccctactatg tgctacagct gacccagttg 84cagcc gcccgaccct cacctttgtc tacttataca atgcggccat cagcttgggc 9ccaaca gctgcctcaa cccctttgtg tacatcgtgc tctgtgagac gttccggagt 96gaagg cctatgggaa tggctactcc agcaacggca acacagggga gcagagtgga tcacgtgg aacaggagaa agaaaataaa ctgctgtgtg aagacctccc aggcacggaa ctttgtgg gccatcaagg tactgtgcct agcgataaca ttgattcaca agggaggaat tagtacaa atgactcact gctgtaa 388 PRT Artificial Sequence human MCHn beta-2 adrenergic receptor C-terminal chimera protein sequence 28 Met Asp Leu Glu Ala Ser Leu Leu Pro Thr Gly Pro Asn Ala Ser Asn Ser Asp Gly Pro Asp Asn Leu Thr Ser Ala Gly Ser Pro Pro Arg 2 Thr Gly Ser Ile Ser Tyr Ile Asn Ile Ile Met Pro Ser Val Phe Gly 35 4r Ile Cys Leu Leu Gly Ile Ile Gly Asn Ser Thr Val Ile Phe Ala 5 Val Val Lys Lys Ser Lys Leu His Trp Cys Asn Asn Val Pro Asp Ile 65 7 Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met 85 9o Phe Met Ile His Gln Leu Met Gly Asn Gly Val Trp His Phe Gly Thr Met Cys Thr Leu Ile Thr Ala Met Asp Ala Asn Ser Gln Phe Ser Thr Tyr Ile Leu Thr Ala Met Ala Ile Asp Arg Tyr Leu Ala Val His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe 2Leu Tyr Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile 222la Ala Tyr Val Arg Ile Leu Gln Arg Met Thr Ser Ser Val Ala 225 234la Ser Gln Arg Ser Ile Arg Leu Arg Thr Lys Arg Val Thr Arg 245 25hr Ala Ile Ala Ile Cys Leu Val Phe Phe Val Cys Trp Ala Pro Tyr 267al Leu Gln Leu Thr Gln Leu Ser Ile Ser Arg Pro Thr Leu Thr 275 28he Val Tyr Leu Tyr Asn Ala Ala Ile Ser Leu Gly Tyr Ala Asn Ser 29Leu Asn Pro Phe Val Tyr Ile Val Leu Cys Glu Thr Phe Arg Ser 33Ser Leu Lys Ala Tyr Gly Asn Gly Tyr Ser Ser Asn Gly Asn Thr Gly 325 33lu Gln Ser Gly Tyr His Val Glu Gln Glu Lys Glu Asn Lys Leu Leu 345lu Asp Leu Pro Gly Thr Glu Asp Phe Val Gly His Gln Gly Thr 355 36al Pro Ser Asp Asn Ile Asp Ser Gln Gly Arg Asn Cys Ser Thr Asn 378er Leu Leu 385 29 6595 DNA Artificial Sequence human MCHn beta-2 adrenergic receptor in pcDNA3.N gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg 6tagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg gcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc gggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 24ttgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 3gttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 36ccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 42cgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt 48atgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 54cagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 6tattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 66cgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 72caacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 78cgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 84tactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 9aaactt aagcttggta ccgagctcgg atccactagt ccagtgtggt ggaattcctg 96cgggg gatccgcccc caccatggac ctggaagcct cgctgctgcc cactggtccc tgccagca acacctctga tggccccgat aacctcactt cggcaggatc acctcctcgc ggggagca tctcctacat caacatcatc atgccttcgg tgttcggcac catctgcctc gggcatca tcgggaactc cacggtcatc ttcgcggtcg tgaagaagtc caagctgcac gtgcaaca acgtccccga catcttcatc atcaacctct cggtagtaga tctcctcttt cctgggca tgcccttcat gatccaccag ctcatgggca atggggtgtg gcactttggg gaccatgt gcaccctcat cacggccatg gatgccaata gtcagttcac cagcacctac cctgaccg ccatggccat tgaccgctac ctggccactg tccaccccat ctcttccacg gttccgga agccctctgt ggccaccctg gtgatctgcc tcctgtgggc cctctccttc cagcatca cccctgtgtg gctgtatgcc agactcatcc ccttcccagg aggtgcagtg ctgcggca tacgcctgcc caacccagac actgacctct actggttcac cctgtaccag tttcctgg cctttgccct gccttttgtg gtcatcacag ccgcatacgt gaggatcctg gcgcatga cgtcctcagt ggcccccgcc tcccagcgca gcatccggct gcggacaaag ggtgaccc gcacagccat cgccatctgt ctggtcttct ttgtgtgctg ggcaccctac tgtgctac agctgaccca gttgtccatc agccgcccga ccctcacctt tgtctactta caatgcgg ccatcagctt gggctatgcc aacagctgcc tcaacccctt tgtgtacatc gctctgtg agacgttccg gagttctttg aaggcctatg ggaatggcta ctccagcaac caacacag gggagcagag tggatatcac gtggaacagg agaaagaaaa taaactgctg 2gaagacc tcccaggcac ggaagacttt gtgggccatc aaggtactgt gcctagcgat 2attgatt cacaagggag gaattgtagt acaaatgact cactgctgta agctctagag 2ccgttta aacccgctga tcagcctcga ctgtgccttc tagttgccag ccatctgttg 222ccctc ccccgtgcct tccttgaccc tggaaggtgc cactcccact gtcctttcct 228aatga ggaaattgca tcgcattgtc tgagtaggtg tcattctatt ctggggggtg 234gggca ggacagcaag ggggaggatt gggaagacaa tagcaggcat gctggggatg 24gggctc tatggcttct gaggcggaaa gaaccagctg gggctctagg gggtatcccc 246ccctg tagcggcgca ttaagcgcgg cgggtgtggt ggttacgcgc agcgtgaccg 252cttgc cagcgcccta gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca 258gccgg ctttccccgt caagctctaa atcggggcat ccctttaggg ttccgattta 264ttacg gcacctcgac cccaaaaaac ttgattaggg tgatggttca cgtagtgggc 27gccctg atagacggtt tttcgccctt tgacgttgga gtccacgttc tttaatagtg 276ttgtt ccaaactgga acaacactca accctatctc ggtctattct tttgatttat 282atttt ggggatttcg gcctattggt taaaaaatga gctgatttaa caaaaattta 288aatta attctgtgga atgtgtgtca gttagggtgt ggaaagtccc caggctcccc 294ggcag aagtatgcaa agcatgcatc tcaattagtc agcaaccagg tgtggaaagt 3caggctc cccagcaggc agaagtatgc aaagcatgca tctcaattag tcagcaacca 3tcccgcc cctaactccg cccatcccgc ccctaactcc gcccagttcc gcccattctc 3cccatgg ctgactaatt ttttttattt atgcagaggc cgaggccgcc tctgcctctg 3tattcca gaagtagtga ggaggctttt ttggaggcct aggcttttgc aaaaagctcc 324gcttg tatatccatt ttcggatctg atcaagagac
aggatgagga tcgtttcgca 33tgaaca agatggattg cacgcaggtt ctccggccgc ttgggtggag aggctattcg 336gactg ggcacaacag acaatcggct gctctgatgc cgccgtgttc cggctgtcag 342gggcg cccggttctt tttgtcaaga ccgacctgtc cggtgccctg aatgaactgc 348gaggc agcgcggcta tcgtggctgg ccacgacggg cgttccttgc gcagctgtgc 354gttgt cactgaagcg ggaagggact ggctgctatt gggcgaagtg ccggggcagg 36cctgtc atctcacctt gctcctgccg agaaagtatc catcatggct gatgcaatgc 366ctgca tacgcttgat ccggctacct gcccattcga ccaccaagcg aaacatcgca 372cgagc acgtactcgg atggaagccg gtcttgtcga tcaggatgat ctggacgaag 378caggg gctcgcgcca gccgaactgt tcgccaggct caaggcgcgc atgcccgacg 384gatct cgtcgtgacc catggcgatg cctgcttgcc gaatatcatg gtggaaaatg 39cttttc tggattcatc gactgtggcc ggctgggtgt ggcggaccgc tatcaggaca 396ttggc tacccgtgat attgctgaag agcttggcgg cgaatgggct gaccgcttcc 4tgcttta cggtatcgcc gctcccgatt cgcagcgcat cgccttctat cgccttcttg 4agttctt ctgagcggga ctctggggtt cgaaatgacc gaccaagcga cgcccaacct 4atcacga gatttcgatt ccaccgccgc cttctatgaa aggttgggct tcggaatcgt 42cgggac gccggctgga tgatcctcca gcgcggggat ctcatgctgg agttcttcgc 426ccaac ttgtttattg cagcttataa tggttacaaa taaagcaata gcatcacaaa 432caaat aaagcatttt tttcactgca ttctagttgt ggtttgtcca aactcatcaa 438cttat catgtctgta taccgtcgac ctctagctag agcttggcgt aatcatggtc 444tgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca tacgagccgg 45ataaag tgtaaagcct ggggtgccta atgagtgagc taactcacat taattgcgtt 456cactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt aatgaatcgg 462gcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct cgctcactga 468tgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat 474tatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca 48gccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc 486agcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata 492accag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc 498ccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcaatgctc 5ctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga 5ccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc 5aagacac gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag 522taggc ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag 528tattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag 534gatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca 54acgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga 546agtgg aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat 552cctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga 558cttgg tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg 564ttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga 57ttacca tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc 576tatca gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac 582ccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc 588atagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc 594gtatg gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc 6gttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt 6cgcagtg ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc 6cgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg 6gcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag 624cttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat 63ccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc 636ttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa 642gaata agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta 648gcatt tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa 654aacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg acgtc 6595 3T homo sapiens 3ro Arg Ser Gly Ser Val Ser Tyr Ile Asn Ile Ile Met Pro Ser Phe Gly Thr Ile Cys Leu Leu Gly Ile Ile Gly Asn Ser Met 2 3A Artificial Sequence human MCHard primer 3atgga cctggaagcc tcg 23 32 2rtificial Sequence human MCHrse primer 32 agggtggcag gggaagtatc 223 DNA Macaca fascicularis 33 atgaatccat ttcactcatc ttgttggaac acctctgccg aactttcaaa caaatcctgg 6agagt ttgcttatca aactgccagt gttgtagata cagtcatcct cccttccatg gggatta tctgttcaac agggctggtt ggcaacatcc tcattgtatt cactataata tccagaa aaaaaacagt ccctgacatc tatatctgca acctggctgt ggctgatttg 24catcg ttggaatgcc ttttcttatt caccagtggg cccgaggggg agagtgggta 3gggggc ctctctgcac catcatcaca tccctggata cttgtaacca atttgcctgt 36catca tgactgtaat gagtgtggac aggtactttg ccctcgtcca accatttcga 42gagtt ggaggacaag gtacaagacc atccggatca atttgggcct ttgggcagct 48tatcc tggcattgcc tgtctggatc tactcgaagg tcatcaaatt taaagacggt 54gagtt gtgcttttga tttgacatcc cctgacgatg tactctggta tacactttat 6caataa caactttctt tttccctcta cccttgattt tggtgtgcta tattttaatt 66ctata cttgggagat gtatcaacag aataaggatg ccagatgttg caatcccagc 72aaaac agagagtgat gaagttgaca aagatggtgc tggtgctggt ggcagtcttt 78aagtg ctgcccctta tcatgtgata caactggtga acttacagat ggaacagccc 84ggcct tctatgtggg ttattacctc tccatctgtc tcagctatgc cagcagcagc 9accctt ttctctacat cctgctgagt ggaaatttcc agaaacgtct gcctcaaatc 96gagag tgactgacaa ggaaatcaaa aatatgggaa acactctgaa atcacacttt g 34acaca fascicularis 34 Met Asn Pro Phe His Ser Ser Cys Trp Asn Thr Ser Ala Glu Leu Ser Lys Ser Trp Asn Lys Glu Phe Ala Tyr Gln Thr Ala Ser Val Val 2 Asp Thr Val Ile Leu Pro Ser Met Ile Gly Ile Ile Cys Ser Thr Gly 35 4u Val Gly Asn Ile Leu Ile Val Phe Thr Ile Ile Arg Ser Arg Lys 5 Lys Thr Val Pro Asp Ile Tyr Ile Cys Asn Leu Ala Val Ala Asp Leu 65 7 Val His Ile Val Gly Met Pro Phe Leu Ile His Gln Trp Ala Arg Gly 85 9y Glu Trp Val Phe Gly Gly Pro Leu Cys Thr Ile Ile Thr Ser Leu Thr Cys Asn Gln Phe Ala Cys Ser Ala Ile Met Thr Val Met Ser Asp Arg Tyr Phe Ala Leu Val Gln Pro Phe Arg Leu Thr Ser Trp Thr Arg Tyr Lys Thr Ile Arg Ile Asn Leu Gly Leu Trp Ala Ala Ser Phe Ile Leu Ala Leu Pro Val Trp Ile Tyr Ser Lys Val Ile Lys Lys Asp Gly Val Glu Ser Cys Ala Phe Asp Leu Thr Ser Pro Asp Val Leu Trp Tyr Thr Leu Tyr Leu Thr Ile Thr Thr Phe Phe Phe 2Leu Pro Leu Ile Leu Val Cys Tyr Ile Leu Ile Leu Cys Tyr Thr 222lu Met Tyr Gln Gln Asn Lys Asp Ala Arg Cys Cys Asn Pro Ser 225 234ro Lys Gln Arg Val Met Lys Leu Thr Lys Met Val Leu Val Leu 245 25al Ala Val Phe Ile Leu Ser Ala Ala Pro Tyr His Val Ile Gln Leu 267sn Leu Gln Met Glu Gln Pro Thr Leu Ala Phe Tyr Val Gly Tyr 275 28yr Leu Ser Ile Cys Leu Ser Tyr Ala Ser Ser Ser Ile Asn Pro Phe 29Tyr Ile Leu Leu Ser Gly Asn Phe Gln Lys Arg Leu Pro Gln Ile 33Gln Arg Arg Val Thr Asp Lys Glu Ile Lys Asn Met Gly Asn Thr Leu 325 33ys Ser His Phe 3423 DNA Macaca fascicularis 35 atgaatccat ttcactcatc ttgttggaac acctctgccg aactttcaaa caaatcctgg 6agagt ttgcttatca aactgccagt gttgtagata cagtcatcct cctttccatg gggatta tctgttcaac agggctggtt ggcaacatcc tcattgtatt cactataata tccagaa aaaaaacagt ccctgacatc tatatctgca acctggctgt ggctgatttg 24catcg ttggaatgcc ttttcttatt caccagtggg cccgaggggg agagtgggta 3gggggc ctctctgcac catcatcaca tccctggata cttgtaacca atttgcctgt 36catca tgactgtaat gagtgtggac aggtactttg ccctcgtcca accatttcga 42gagtt ggaggacaag gtacaagacc atccggatca atttgggcct ttgggcagct 48tatcc tggcattgcc tgtctggatc tactcgaagg tcatcaaatt taaagacggt 54gagtt gtgcttttga tttgacatcc cctgacgatg tactctggta tacactttat 6caataa caactttctt tttccctcta cccttgattt tggtgtgcta tattttaatt 66ctata cttgggagat gtatcaacag aataaggatg ccagatgttg caatcccagc 72aaaac agagagtgat gaagttgaca aagatggtgc tggtgctggt ggcagtcttt 78aagtg ctgcccctta tcatgtgata caactggtga acttacagat ggaacagccc 84ggcct tctatgtggg ttattacctc tccatctgtc tcagctatgc cagcagcagc 9accctt ttctctacat cctgctgagt ggaaatttcc agaaacgtct gcctcaaatc 96gagag tgactgacaa ggaaatcaaa aatatgggaa acactctgaa atcacacttt g 34acaca fascicularis 36 Met Asn Pro Phe His Ser Ser Cys Trp Asn Thr Ser Ala Glu Leu Ser Lys Ser Trp Asn Lys Glu Phe Ala Tyr Gln Thr Ala Ser Val Val 2 Asp Thr Val Ile Leu Leu Ser Met Ile Gly Ile Ile Cys Ser Thr Gly 35 4u Val Gly Asn Ile Leu Ile Val Phe Thr Ile Ile Arg Ser Arg Lys 5 Lys Thr Val Pro Asp Ile Tyr Ile Cys Asn Leu Ala Val Ala Asp Leu 65 7 Val His Ile Val Gly Met Pro Phe Leu Ile His Gln Trp Ala Arg Gly 85 9y Glu Trp Val Phe Gly Gly Pro Leu Cys Thr Ile Ile Thr Ser Leu Thr Cys Asn Gln Phe Ala Cys Ser Ala Ile Met Thr Val Met Ser Asp Arg Tyr Phe Ala Leu Val Gln Pro Phe Arg Leu Thr Ser Trp Thr Arg Tyr Lys Thr Ile Arg Ile Asn Leu Gly Leu Trp Ala Ala Ser Phe Ile Leu Ala Leu Pro Val Trp Ile Tyr Ser Lys Val Ile Lys Lys Asp Gly Val Glu Ser Cys Ala Phe Asp Leu Thr Ser Pro Asp Val Leu Trp Tyr Thr Leu Tyr Leu Thr Ile Thr Thr Phe Phe Phe 2Leu Pro Leu Ile Leu Val Cys Tyr Ile Leu Ile Leu Cys Tyr Thr 222lu Met Tyr Gln Gln Asn Lys Asp Ala Arg Cys Cys Asn Pro Ser 225 234ro Lys Gln Arg Val Met Lys Leu Thr Lys Met Val Leu Val Leu 245 25al Ala Val Phe Ile Leu Ser Ala Ala Pro Tyr His Val Ile Gln Leu 267sn Leu Gln Met Glu Gln Pro Thr Leu Ala Phe Tyr Val Gly Tyr 275 28yr Leu Ser Ile Cys Leu Ser Tyr Ala Ser Ser Ser Ile Asn Pro Phe 29Tyr Ile Leu Leu Ser Gly Asn Phe Gln Lys Arg Leu Pro Gln Ile 33Gln Arg Arg Val Thr Asp Lys Glu Ile Lys Asn Met Gly Asn Thr Leu 325 33ys Ser His Phe 3423 DNA Macaca fascicularis 37 atgaatccat ttcactcatc ttgttggaac acctctgccg aactttcaaa caaatcctgg 6agagt ttgcttatca aactgccagt gttgtagata cagtcatcct cccttccatg gggatta tctgttcaac agggctggtt ggcaacatcc tcattgtatt cactataata tccagaa aaaaaacagt ccctgacatc tatatctgca acctggctgt ggctgatttg 24catcg ttggaatgcc ttttcttatt caccagtggg cccgaggggg agagtgggta 3gggggc ctctctgcac catcatcaca tccctggata cttgtaacca atttgcctgt 36catca tgactgtaat gagtgtggac aggtactttg ccctcgtcca accatttcga 42aagtt ggagaacaag gtacaagacc atccggatca atttgggcct ttgggcagct 48tatcc tggcattgcc tgtctggatc tactcgaagg tcatcaaatt taaagacggt 54gagtt gtgcttttga tttgacatcc cctgacgatg tactctggta tacactttat 6caataa caactttctt tttccctcta cccttgattt tggtgtgcta tattttaatt 66ctata cttgggagat gtatcaacag aataaggatg ccagatgttg caatcccagc 72aaaac agagagtgat gaagttgaca aagatggtgc tggtgctggt ggcagtcttt 78aagtg ctgcccctta tcatgtgata caactggtga acttacagat ggaacagccc 84ggcct tctatgtggg ttattacctc tccatctgtc tcagctatgc cagcagcagc 9accctt ttctctacat cctgctgagt ggaaatttcc agaaacgtct gcctcaaatc 96gagag tgactgacaa ggaaatcaaa aatatgggaa acactctgaa atcacacttt g 993 DNA Canis sp. 38 atgtattcac ttcactcatc ctgttggaac acctctgctg aacctttgaa caaatcctgc 6agagt ttgcttatca caccctcagc attttagata caatcatcct cccttctatg gggatta tctgttcaat ggggctagtt ggcaacatcc tcattgtatt cactataata tccagga aaaaaaccat tcctgacatt tatatctgca acctggctgt ggctgatctg 24catca ttggaatgcc atttcttatt catcagtggg cccggggagg agagtgggtg 3gggggc ccctctgcac cattatcaca tccctggata cctgcaacca gtttgcctgt 36catca tgactgtgat gagtatagac aggtacttgg ctctcgtcca accatttcga 42aagtt ggagaacgag gtacaagacc atccgcatca atttgggcct ttgggcagct 48cattc tggcgctgcc tgtctgggtc tactcgaagg tcatcaaatt taaagacggc 54gagtt gtgcttttga tttaacatcc cctgacgatg tactccggta tacactttat 6cgataa caactttttt tttccctttg cctttgattt tggtgtgcta tattttaatt 66ctata cttgggagat gtatcaacag aataaagatg caagatgtta caatcccagt 72aaaag agagagtgat gaagctgaca aagatggtgc tggtgctggt ggcggtcttt 78aagtg ctgcccccta ccacgtgata caactggtga acttaaagat gcagcagccc 84ggcct tccatgtagg ctattatctc tccatctgtt tcagctatgc cagcagcagc 9accctt tcctctacat catgctgagt ggaaatttcc ggaaacgcct acctcaagta 96gagag tgactgagaa atcaacaata tag 993 39 33anis sp. 39 Met Tyr Ser Leu His Ser Ser Cys Trp Asn Thr Ser Ala Glu Pro Leu Lys Ser Cys Asn Lys Glu Phe Ala Tyr His Thr Leu Ser Ile Leu 2 Asp Thr Ile Ile Leu Pro Ser Met Ile Gly Ile Ile Cys Ser Met Gly 35 4u Val Gly Asn Ile Leu Ile Val Phe Thr Ile Ile Arg Ser Arg Lys 5 Lys Thr Ile Pro Asp Ile Tyr Ile Cys Asn Leu Ala Val Ala Asp Leu 65 7 Val His Ile Ile Gly Met Pro Phe Leu Ile His Gln Trp Ala Arg Gly 85 9y Glu Trp Val Phe Gly Gly Pro Leu Cys Thr Ile Ile Thr Ser Leu Thr Cys Asn Gln Phe Ala Cys Ser Ala Ile Met Thr Val Met Ser Asp Arg Tyr Leu Ala Leu Val Gln Pro Phe Arg Leu Thr Ser Trp Thr Arg Tyr Lys Thr Ile Arg Ile Asn Leu Gly Leu Trp Ala Ala Ser Phe Ile Leu Ala Leu Pro Val Trp Val Tyr Ser Lys Val Ile Lys Lys Asp Gly Val Glu Ser Cys Ala Phe Asp Leu Thr Ser Pro Asp Val Leu Arg Tyr Thr Leu Tyr Leu Thr Ile Thr Thr Phe Phe Phe 2Leu Pro Leu Ile Leu Val Cys Tyr Ile Leu Ile Leu Cys Tyr Thr 222lu Met Tyr Gln Gln Asn Lys Asp Ala Arg Cys Tyr Asn Pro Ser 225 234ro Lys Glu Arg Val Met Lys Leu Thr Lys Met Val Leu Val Leu 245 25al Ala Val Phe Ile Leu Ser Ala Ala Pro Tyr His Val Ile Gln Leu 267sn Leu Lys Met Gln Gln Pro Thr Leu Ala Phe His Val Gly Tyr 275 28yr Leu Ser Ile Cys Phe Ser Tyr Ala Ser Ser Ser Ile Asn Pro Phe 29Tyr Ile Met Leu Ser Gly Asn Phe Arg Lys Arg Leu Pro Gln Val 33Gln Arg Arg Val Thr Glu Lys Ser Thr Ile 325 3362 DNA Artificial Sequence Cynomolgus macaque MCHsequence with BspE site added for C-terminal chimeras 4cctgg aagcctcgct gctgcccact ggtcccaaca ccagcaacac ctctgatggc 6taacc tcacctcggc aggatcacct cctcgctcag ggagcgtctc ctacatcaac atcatgc cttcggtgtt cggcaccatc tgcctcctgg gcatcatcgg gaactccatg atcttcg cggtcgtgaa gaagtccaag ctgcactggt gcaacaatgt ccccgacatc 24catca acctctcggt ggtggatctc ctctttctcc tgggcatgcc cttcatgatc 3agctca tgggcaatgg ggtgtggcac tttggggaga ccatgtgcac cctcatcacg 36ggatg ccaatagtca gttcaccagc acctacatcc tgaccgccat ggccattgac 42cctgg ccaccgtcca ccccatctct tccacaaagt tccggaagcc ctctgtggcc 48ggtga tctgcctcct gtgggccctc tccttcatca
gcatcacccc cgtgtggttg 54cagac tcatcccctt cccaggaggt gcagtgggct gcggcatccg cttgcccaac 6acactg acctttactg gttcaccctg taccagtttt tcctggcctt tgccctgccc 66ggtca tcacggccgc atacgtgagg atcctgcagc gcatgacgtc ctcagtggcc 72ctccc agcgcagcat ccggctgcgg acaaagaggg tgacccgcac agccatcgcc 78cctgg tcttctttgt gtgctgggca ccctactatg tgctacagct gacccagttg 84cagcc gcccgaccct cacctttgtc tacctgtaca atgcggccat cagcttgggc 9ccaaca gctgcctcaa cccctttgtg tacattgtgc tctgcgagac gttccggaaa 96ggtcc tttcggtgaa gcctgcagcc caggggcagc ttcgcgctgt cagcaacgct gacggctg acgaggagag gacagaaagc aaaggtacct ga A Artificial Sequence Cynomolgus macaque MCHn NPYhimera 4cctgg aagcctcgct gctgcccact ggtcccaaca ccagcaacac ctctgatggc 6taacc tcacctcggc aggatcacct cctcgctcag ggagcgtctc ctacatcaac atcatgc cttcggtgtt cggcaccatc tgcctcctgg gcatcatcgg gaactccatg atcttcg cggtcgtgaa gaagtccaag ctgcactggt gcaacaatgt ccccgacatc 24catca acctctcggt ggtggatctc ctctttctcc tgggcatgcc cttcatgatc 3agctca tgggcaatgg ggtgtggcac tttggggaga ccatgtgcac cctcatcacg 36ggatg ccaatagtca gttcaccagc acctacatcc tgaccgccat ggccattgac 42cctgg ccaccgtcca ccccatctct tccacaaagt tccggaagcc ctctgtggcc 48ggtga tctgcctcct gtgggccctc tccttcatca gcatcacccc cgtgtggttg 54cagac tcatcccctt cccaggaggt gcagtgggct gcggcatccg cttgcccaac 6acactg acctttactg gttcaccctg taccagtttt tcctggcctt tgccctgccc 66ggtca tcacggccgc atacgtgagg atcctgatac gcctaaaaag gagaaacaac 72ggaca agatgagaga caataagtac aggtccagtg aaaccaaaag ggtgacccgc 78catcg ccatctgcct ggtcttcttt gtgtgctggg caccctacta tgtgctacag 84ccagt tgtccatcag ccgcccgacc ctcacctttg tctacctgta caatgcggcc 9gcttgg gctacgccaa cagctgcctc aacccctttg tgtacattgt gctctgcgag 96ccgca aacgcttggt cctttcggtg aagcctgcag cccaggggca gcttcgcgct cagcaacg ctcagacggc tgacgaggag aggacagaaa gcaaaggtac ctga 357 PRT artificial sequence Cynomolgus macaque MCHn NPYhimera - amino acid sequence 42 Met Asp Leu Glu Ala Ser Leu Leu Pro Thr Gly Pro Asn Thr Ser Asn Ser Asp Gly Pro Asp Asn Leu Thr Ser Ala Gly Ser Pro Pro Arg 2 Ser Gly Ser Val Ser Tyr Ile Asn Ile Ile Met Pro Ser Val Phe Gly 35 4r Ile Cys Leu Leu Gly Ile Ile Gly Asn Ser Met Val Ile Phe Ala 5 Val Val Lys Lys Ser Lys Leu His Trp Cys Asn Asn Val Pro Asp Ile 65 7 Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met 85 9o Phe Met Ile His Gln Leu Met Gly Asn Gly Val Trp His Phe Gly Thr Met Cys Thr Leu Ile Thr Ala Met Asp Ala Asn Ser Gln Phe Ser Thr Tyr Ile Leu Thr Ala Met Ala Ile Asp Arg Tyr Leu Ala Val His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe 2Leu Tyr Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile 222la Ala Tyr Val Arg Ile Leu Ile Arg Leu Lys Arg Arg Asn Asn 225 234et Asp Lys Met Arg Asp Asn Lys Tyr Arg Ser Ser Glu Thr Lys 245 25rg Val Thr Arg Thr Ala Ile Ala Ile Cys Leu Val Phe Phe Val Cys 267la Pro Tyr Tyr Val Leu Gln Leu Thr Gln Leu Ser Ile Ser Arg 275 28ro Thr Leu Thr Phe Val Tyr Leu Tyr Asn Ala Ala Ile Ser Leu Gly 29Ala Asn Ser Cys Leu Asn Pro Phe Val Tyr Ile Val Leu Cys Glu 33Thr Phe Arg Lys Arg Leu Val Leu Ser Val Lys Pro Ala Ala Gln Gly 325 33ln Leu Arg Ala Val Ser Asn Ala Gln Thr Ala Asp Glu Glu Arg Thr 345er Lys Gly Thr 355 43 A Artificial Sequence Cynomolgus macaque MCHn NPYminal chimera 43 atggacctgg aagcctcgct gctgcccact ggtcccaaca ccagcaacac ctctgatggc 6taacc tcacctcggc aggatcacct cctcgctcag ggagcgtctc ctacatcaac atcatgc cttcggtgtt cggcaccatc tgcctcctgg gcatcatcgg gaactccatg atcttcg cggtcgtgaa gaagtccaag ctgcactggt gcaacaatgt ccccgacatc 24catca acctctcggt ggtggatctc ctctttctcc tgggcatgcc cttcatgatc 3agctca tgggcaatgg ggtgtggcac tttggggaga ccatgtgcac cctcatcacg 36ggatg ccaatagtca gttcaccagc acctacatcc tgaccgccat ggccattgac 42cctgg ccaccgtcca ccccatctct tccacaaagt tccggaagcc ctctgtggcc 48ggtga tctgcctcct gtgggccctc tccttcatca gcatcacccc cgtgtggttg 54cagac tcatcccctt cccaggaggt gcagtgggct gcggcatccg cttgcccaac 6acactg acctttactg gttcaccctg taccagtttt tcctggcctt tgccctgccc 66ggtca tcacggccgc atacgtgagg atcctgcagc gcatgacgtc ctcagtggcc 72ctccc agcgcagcat ccggctgcgg acaaagaggg tgacccgcac agccatcgcc 78cctgg tcttctttgt gtgctgggca ccctactatg tgctacagct gacccagttg 84cagcc gcccgaccct cacctttgtc tacctgtaca atgcggccat cagcttgggc 9ccaaca gctgcctcaa cccctttgtg tacattgtgc tctgcgagac gttccggaga 96gcagt tcttcttcaa cttttgtgat ttccggtctc gggatgatga ttatgaaaca agccatgt ccacgatgca cacagatgtt tccaaaactt ctttgaagca agcaagccca cgcattta aaaaaatcaa caacaatgat gataatgaaa aaatctga 375 PRT Artificial Sequence Cynomolgus macaque MCHn NPYminal chimera - amino acid sequence 44 Met Asp Leu Glu Ala Ser Leu Leu Pro Thr Gly Pro Asn Thr Ser Asn Ser Asp Gly Pro Asp Asn Leu Thr Ser Ala Gly Ser Pro Pro Arg 2 Ser Gly Ser Val Ser Tyr Ile Asn Ile Ile Met Pro Ser Val Phe Gly 35 4r Ile Cys Leu Leu Gly Ile Ile Gly Asn Ser Met Val Ile Phe Ala 5 Val Val Lys Lys Ser Lys Leu His Trp Cys Asn Asn Val Pro Asp Ile 65 7 Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met 85 9o Phe Met Ile His Gln Leu Met Gly Asn Gly Val Trp His Phe Gly Thr Met Cys Thr Leu Ile Thr Ala Met Asp Ala Asn Ser Gln Phe Ser Thr Tyr Ile Leu Thr Ala Met Ala Ile Asp Arg Tyr Leu Ala Val His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe 2Leu Tyr Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile 222la Ala Tyr Val Arg Ile Leu Gln Arg Met Thr Ser Ser Val Ala 225 234la Ser Gln Arg Ser Ile Arg Leu Arg Thr Lys Arg Val Thr Arg 245 25hr Ala Ile Ala Ile Cys Leu Val Phe Phe Val Cys Trp Ala Pro Tyr 267al Leu Gln Leu Thr Gln Leu Ser Ile Ser Arg Pro Thr Leu Thr 275 28he Val Tyr Leu Tyr Asn Ala Ala Ile Ser Leu Gly Tyr Ala Asn Ser 29Leu Asn Pro Phe Val Tyr Ile Val Leu Cys Glu Thr Phe Arg Arg 33Asp Leu Gln Phe Phe Phe Asn Phe Cys Asp Phe Arg Ser Arg Asp Asp 325 33sp Tyr Glu Thr Ile Ala Met Ser Thr Met His Thr Asp Val Ser Lys 345er Leu Lys Gln Ala Ser Pro Val Ala Phe Lys Lys Ile Asn Asn 355 36sn Asp Asp Asn Glu Lys Ile 375 A Artificial Sequence Cynomolgus macaque MCHn beta-2 adrenergic receptor C-terminal chimera 45 atggacctgg aagcctcgct gctgcccact ggtcccaaca ccagcaacac ctctgatggc 6taacc tcacctcggc aggatcacct cctcgctcag ggagcgtctc ctacatcaac atcatgc cttcggtgtt cggcaccatc tgcctcctgg gcatcatcgg gaactccatg atcttcg cggtcgtgaa gaagtccaag ctgcactggt gcaacaatgt ccccgacatc 24catca acctctcggt ggtggatctc ctctttctcc tgggcatgcc cttcatgatc 3agctca tgggcaatgg ggtgtggcac tttggggaga ccatgtgcac cctcatcacg 36ggatg ccaatagtca gttcaccagc acctacatcc tgaccgccat ggccattgac 42cctgg ccaccgtcca ccccatctct tccacaaagt tccggaagcc ctctgtggcc 48ggtga tctgcctcct gtgggccctc tccttcatca gcatcacccc cgtgtggttg 54cagac tcatcccctt cccaggaggt gcagtgggct gcggcatccg cttgcccaac 6acactg acctttactg gttcaccctg taccagtttt tcctggcctt tgccctgccc 66ggtca tcacggccgc atacgtgagg atcctgcagc gcatgacgtc ctcagtggcc 72ctccc agcgcagcat ccggctgcgg acaaagaggg tgacccgcac agccatcgcc 78cctgg tcttctttgt gtgctgggca ccctactatg tgctacagct gacccagttg 84cagcc gcccgaccct cacctttgtc tacctgtaca atgcggccat cagcttgggc 9ccaaca gctgcctcaa cccctttgtg tacattgtgc tctgcgagac gttccggagt 96gaagg cctatgggaa tggctactcc agcaacggca acacagggga gcagagtgga tcacgtgg aacaggagaa agaaaataaa ctgctgtgtg aagacctccc aggcacggaa ctttgtgg gccatcaagg tactgtgcct agcgataaca ttgattcaca agggaggaat tagtacaa atgactcact gctgtaa 388 PRT Artificial Sequence Cynomolgus macaque MCHn beta-2 adrenergic receptor C-terminal chimera - amino acid sequence 46 Met Asp Leu Glu Ala Ser Leu Leu Pro Thr Gly Pro Asn Thr Ser Asn Ser Asp Gly Pro Asp Asn Leu Thr Ser Ala Gly Ser Pro Pro Arg 2 Ser Gly Ser Val Ser Tyr Ile Asn Ile Ile Met Pro Ser Val Phe Gly 35 4r Ile Cys Leu Leu Gly Ile Ile Gly Asn Ser Met Val Ile Phe Ala 5 Val Val Lys Lys Ser Lys Leu His Trp Cys Asn Asn Val Pro Asp Ile 65 7 Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met 85 9o Phe Met Ile His Gln Leu Met Gly Asn Gly Val Trp His Phe Gly Thr Met Cys Thr Leu Ile Thr Ala Met Asp Ala Asn Ser Gln Phe Ser Thr Tyr Ile Leu Thr Ala Met Ala Ile Asp Arg Tyr Leu Ala Val His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe 2Leu Tyr Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile 222la Ala Tyr Val Arg Ile Leu Gln Arg Met Thr Ser Ser Val Ala 225 234la Ser Gln Arg Ser Ile Arg Leu Arg Thr Lys Arg Val Thr Arg 245 25hr Ala Ile Ala Ile Cys Leu Val Phe Phe Val Cys Trp Ala Pro Tyr 267al Leu Gln Leu Thr Gln Leu Ser Ile Ser Arg Pro Thr Leu Thr 275 28he Val Tyr Leu Tyr Asn Ala Ala Ile Ser Leu Gly Tyr Ala Asn Ser 29Leu Asn Pro Phe Val Tyr Ile Val Leu Cys Glu Thr Phe Arg Ser 33Ser Leu Lys Ala Tyr Gly Asn Gly Tyr Ser Ser Asn Gly Asn Thr Gly 325 33lu Gln Ser Gly Tyr His Val Glu Gln Glu Lys Glu Asn Lys Leu Leu 345lu Asp Leu Pro Gly Thr Glu Asp Phe Val Gly His Gln Gly Thr 355 36al Pro Ser Asp Asn Ile Asp Ser Gln Gly Arg Asn Cys Ser Thr Asn 378er Leu Leu 385 47 A Artificial Sequence Cynomolgus macaque MCHR N-terminal chimera 47 atgaatccat ttcactcatc ttgttggaac acctctgccg aactttcaaa caaatcctgg 6agagt ttgcttatca aactgccagt gttgtagata ccgtctccta catcaacatc atgcctt cggtgttcgg caccatctgc ctcctgggca tcatcgggaa ctccatggtc ttcgcgg tcgtgaagaa gtccaagctg cactggtgca acaatgtccc cgacatcttc 24caacc tctcggtggt ggatctcctc tttctcctgg gcatgccctt catgatccac 3tcatgg gcaatggggt gtggcacttt ggggagacca tgtgcaccct catcacggcc 36tgcca atagtcagtt caccagcacc tacatcctga ccgccatggc cattgaccgc 42ggcca ccgtccaccc catctcttcc acaaagttcc ggaagccctc tgtggccacc 48gatct gcctcctgtg ggccctctcc ttcatcagca tcacccccgt gtggttgtat 54actca tccccttccc aggaggtgca gtgggctgcg gcatccgctt gcccaacccg 6ctgacc tttactggtt caccctgtac cagtttttcc tggcctttgc cctgcccttc 66catca cggccgcata cgtgaggatc ctgcagcgca tgacgtcctc agtggccccc 72ccagc gcagcatccg gctgcggaca aagagggtga cccgcacagc catcgccatc 78ggtct tctttgtgtg ctgggcaccc tactatgtgc tacagctgac ccagttgtcc 84ccgcc cgaccctcac ctttgtctac ctgtacaatg cggccatcag cttgggctac 9acagct gcctcaaccc ctttgtgtac attgtgctct gcgagacgtt ccgcaaacgc 96ccttt cggtgaagcc tgcagcccag gggcagcttc gcgctgtcag caacgctcag ggctgacg aggagaggac agaaagcaaa ggtacctga 352 PRT Artificial Sequence Cynomolgus macaque MCHR N-terminal chimera - amino acid sequence 48 Met Asn Pro Phe His Ser Ser Cys Trp Asn Thr Ser Ala Glu Leu Ser Lys Ser Trp Asn Lys Glu Phe Ala Tyr Gln Thr Ala Ser Val Val 2 Asp Thr Val Ser Tyr Ile Asn Ile Ile Met Pro Ser Val Phe Gly Thr 35 4e Cys Leu Leu Gly Ile Ile Gly Asn Ser Met Val Ile Phe Ala Val 5 Val Lys Lys Ser Lys Leu His Trp Cys Asn Asn Val Pro Asp Ile Phe 65 7 Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met Pro 85 9e Met Ile His Gln Leu Met Gly Asn Gly Val Trp His Phe Gly Glu Met Cys Thr Leu Ile Thr Ala Met Asp Ala Asn Ser Gln Phe Thr Thr Tyr Ile Leu Thr Ala Met Ala Ile Asp Arg Tyr Leu Ala Thr His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Pro Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Gly Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe Thr 2Tyr Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile Thr 222la Tyr Val Arg Ile Leu Gln Arg Met Thr Ser Ser Val Ala Pro 225 234er Gln Arg Ser Ile Arg Leu Arg Thr Lys Arg Val Thr Arg Thr 245 25la Ile Ala Ile Cys Leu Val Phe Phe Val Cys Trp Ala Pro Tyr Tyr 267eu Gln Leu Thr Gln Leu Ser Ile Ser Arg Pro Thr Leu Thr Phe 275 28al Tyr Leu Tyr Asn Ala Ala Ile Ser Leu Gly Tyr Ala Asn Ser Cys 29Asn Pro Phe Val Tyr Ile Val Leu Cys Glu Thr Phe Arg Lys Arg 33Leu Val Leu Ser Val Lys Pro Ala Ala Gln Gly Gln Leu Arg Ala Val 325 33er Asn Ala Gln Thr Ala Asp Glu Glu Arg Thr Glu Ser Lys Gly Thr 3458rtificial Sequence Cynomolgus macaque MCHR IC3 chimera 49 atggacctgg aagcctcgct gctgcccact ggtcccaaca ccagcaacac ctctgatggc 6taacc tcacctcggc aggatcacct cctcgctcag ggagcgtctc ctacatcaac atcatgc cttcggtgtt cggcaccatc tgcctcctgg
gcatcatcgg gaactccatg atcttcg cggtcgtgaa gaagtccaag ctgcactggt gcaacaatgt ccccgacatc 24catca acctctcggt ggtggatctc ctctttctcc tgggcatgcc cttcatgatc 3agctca tgggcaatgg ggtgtggcac tttggggaga ccatgtgcac cctcatcacg 36ggatg ccaatagtca gttcaccagc acctacatcc tgaccgccat ggccattgac 42cctgg ccaccgtcca ccccatctct tccacaaagt tccggaagcc ctctgtggcc 48ggtga tctgcctcct gtgggccctc tccttcatca gcatcacccc cgtgtggttg 54cagac tcatcccctt cccaggaggt gcagtgggct gcggcatccg cttgcccaac 6acactg acctttactg gttcaccctg taccagtttt tcctggcctt tgccctgccc 66ggtca tcacggccgc atacgtgagg atcctgtgct atacttggga gatgtatcaa 72taagg atgccagatg ttgcaatccc agcgtaccaa aacagagagt gatgaaggtg 78cacag ccatcgccat ctgcctggtc ttctttgtgt gctgggcacc ctactatgtg 84gctga cccagttgtc catcagccgc ccgaccctca cctttgtcta cctgtacaat 9ccatca gcttgggcta cgccaacagc tgcctcaacc cctttgtgta cattgtgctc 96gacgt tccgcaaacg cttggtcctt tcggtgaagc ctgcagccca ggggcagctt cgctgtca gcaacgctca gacggctgac gaggagagga cagaaagcaa aggtacctga 359 PRT Artificial Sequence Cynomolgus macaque MCHR IC3 chimera - amino acid sequence 5sp Leu Glu Ala Ser Leu Leu Pro Thr Gly Pro Asn Thr Ser Asn Ser Asp Gly Pro Asp Asn Leu Thr Ser Ala Gly Ser Pro Pro Arg 2 Ser Gly Ser Val Ser Tyr Ile Asn Ile Ile Met Pro Ser Val Phe Gly 35 4r Ile Cys Leu Leu Gly Ile Ile Gly Asn Ser Met Val Ile Phe Ala 5 Val Val Lys Lys Ser Lys Leu His Trp Cys Asn Asn Val Pro Asp Ile 65 7 Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met 85 9o Phe Met Ile His Gln Leu Met Gly Asn Gly Val Trp His Phe Gly Thr Met Cys Thr Leu Ile Thr Ala Met Asp Ala Asn Ser Gln Phe Ser Thr Tyr Ile Leu Thr Ala Met Ala Ile Asp Arg Tyr Leu Ala Val His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe 2Leu Tyr Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile 222la Ala Tyr Val Arg Ile Leu Cys Tyr Thr Trp Glu Met Tyr Gln 225 234sn Lys Asp Ala Arg Cys Cys Asn Pro Ser Val Pro Lys Gln Arg 245 25al Met Lys Val Thr Arg Thr Ala Ile Ala Ile Cys Leu Val Phe Phe 267ys Trp Ala Pro Tyr Tyr Val Leu Gln Leu Thr Gln Leu Ser Ile 275 28er Arg Pro Thr Leu Thr Phe Val Tyr Leu Tyr Asn Ala Ala Ile Ser 29Gly Tyr Ala Asn Ser Cys Leu Asn Pro Phe Val Tyr Ile Val Leu 33Cys Glu Thr Phe Arg Lys Arg Leu Val Leu Ser Val Lys Pro Ala Ala 325 33ln Gly Gln Leu Arg Ala Val Ser Asn Ala Gln Thr Ala Asp Glu Glu 345hr Glu Ser Lys Gly Thr 355 5DNA Artificial Sequence Cynomolgus macaque MCHR C-terminal chimera 5cctgg aagcctcgct gctgcccact ggtcccaaca ccagcaacac ctctgatggc 6taacc tcacctcggc aggatcacct cctcgctcag ggagcgtctc ctacatcaac atcatgc cttcggtgtt cggcaccatc tgcctcctgg gcatcatcgg gaactccatg atcttcg cggtcgtgaa gaagtccaag ctgcactggt gcaacaatgt ccccgacatc 24catca acctctcggt ggtggatctc ctctttctcc tgggcatgcc cttcatgatc 3agctca tgggcaatgg ggtgtggcac tttggggaga ccatgtgcac cctcatcacg 36ggatg ccaatagtca gttcaccagc acctacatcc tgaccgccat ggccattgac 42cctgg ccaccgtcca ccccatctct tccacaaagt tccggaagcc ctctgtggcc 48ggtga tctgcctcct gtgggccctc tccttcatca gcatcacccc cgtgtggttg 54cagac tcatcccctt cccaggaggt gcagtgggct gcggcatccg cttgcccaac 6acactg acctttactg gttcaccctg taccagtttt tcctggcctt tgccctgccc 66ggtca tcacggccgc atacgtgagg atcctgcagc gcatgacgtc ctcagtggcc 72ctccc agcgcagcat ccggctgcgg acaaagaggg tgacccgcac agccatcgcc 78cctgg tcttctttgt gtgctgggca ccctactatg tgctacagct gacccagttg 84cagcc gcccgaccct cacctttgtc tacctgtaca atgcggccat cagcttgggc 9ccaaca gctgcctcaa cccctttgtg tacattgtgc tctgcgagac gttccggaaa 96gcctc aaatccaaag gagagtgact gacaaggaaa tcaaaaatat gggaaacact gaaatcac acttttag 345 PRT Artificial Sequence Cynomolgus macaque MCHR C-terminal chimera - amino acid sequence 52 Met Asp Leu Glu Ala Ser Leu Leu Pro Thr Gly Pro Asn Thr Ser Asn Ser Asp Gly Pro Asp Asn Leu Thr Ser Ala Gly Ser Pro Pro Arg 2 Ser Gly Ser Val Ser Tyr Ile Asn Ile Ile Met Pro Ser Val Phe Gly 35 4r Ile Cys Leu Leu Gly Ile Ile Gly Asn Ser Met Val Ile Phe Ala 5 Val Val Lys Lys Ser Lys Leu His Trp Cys Asn Asn Val Pro Asp Ile 65 7 Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met 85 9o Phe Met Ile His Gln Leu Met Gly Asn Gly Val Trp His Phe Gly Thr Met Cys Thr Leu Ile Thr Ala Met Asp Ala Asn Ser Gln Phe Ser Thr Tyr Ile Leu Thr Ala Met Ala Ile Asp Arg Tyr Leu Ala Val His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe 2Leu Tyr Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile 222la Ala Tyr Val Arg Ile Leu Gln Arg Met Thr Ser Ser Val Ala 225 234la Ser Gln Arg Ser Ile Arg Leu Arg Thr Lys Arg Val Thr Arg 245 25hr Ala Ile Ala Ile Cys Leu Val Phe Phe Val Cys Trp Ala Pro Tyr 267al Leu Gln Leu Thr Gln Leu Ser Ile Ser Arg Pro Thr Leu Thr 275 28he Val Tyr Leu Tyr Asn Ala Ala Ile Ser Leu Gly Tyr Ala Asn Ser 29Leu Asn Pro Phe Val Tyr Ile Val Leu Cys Glu Thr Phe Arg Lys 33Arg Leu Pro Gln Ile Gln Arg Arg Val Thr Asp Lys Glu Ile Lys Asn 325 33et Gly Asn Thr Leu Lys Ser His Phe 343 2Macaca fascicularis 53 atgtcagtga gagccgcgaa ggagggagta gggagggcag ttgggcttgg aggcggcagc 6ccagg ctgccaagga agaccccctt cccgactgcg gggcttgcgc tcctggacaa ggcaggc gctggaggct gccgcagcct gcgtgggtgg aggggagctc agcttggttg gagccgg cgaccggcac tggctgg 29 PRT Macaca fascicularis 54 Met Ser Val Arg Ala Ala Lys Glu Gly Val Gly Arg Ala Val Gly Leu Gly Gly Ser Gly Cys Gln Ala Ala Lys Glu Asp Pro Leu Pro Asp 2 Cys Gly Ala Cys Ala Pro Gly Gln Gly Gly Arg Arg Trp Arg Leu Pro 35 4n Pro Ala Trp Val Glu Gly Ser Ser Ala Trp Leu Trp Glu Pro Ala 5 Thr Gly Thr Gly Trp 65 55 A Macaca fascicularis 55 atgtcagtga gagccgcgaa ggagggagta gggagggcag ttgggcttgg aggcggcagc 6ccagg ctgccaagga agaccccctt cccgactgcg gggcttgcgc tcctggacaa ggcaggc gctggaggct gccgcagcct gcgtgggtgg aggggagctc agcttggttg gagccgg cgaccggcac tggctggatg gacctggaag cctcgctgct gcccactggt 24cacca gcaacacctc tgatggcccc gataacctca cctcggcagg atcacctcct 3caggga gcgtctccta catcaacatc atcatgcctt cggtgttcgg caccatctgc 36gggca tcatcgggaa ctccatggtc atcttcgcgg tcgtgaagaa gtccaagctg 42gtgca acaatgtccc cgacatcttc atcatcaacc tctcggtggt ggatctcctc 48cctgg gcatgccctt catgatccac cagctcatgg gcaatggggt gtggcacttt 54gacca tgtgcaccct catcacggcc atggatgcca atagtcagtt caccagcacc 6tcctga ccgccatggc cattgaccgc tacctggcca ccgtccaccc catctcttcc 66gttcc ggaagccctc tgtggccacc ctggtgatct gcctcctgtg ggccctctcc 72cagca tcacccccgt gtggttgtat gccagactca tccccttccc aggaggtgca 78ctgcg gcatccgctt gcccaacccg gacactgacc tttactggtt caccctgtac 84tttcc tggcctttgc cctgcccttc gtggtcatca cggccgcata cgtgaggatc 9agcgca tgacgtcctc agtggccccc gcctcccagc gcagcatccg gctgcggaca 96ggtga cccgcacagc catcgccatc tgcctggtct tctttgtgtg ctgggcaccc ctatgtgc tacagctgac ccagttgtcc atcagccgcc cgaccctcac ctttgtctac gtacaatg cggccatcag cttgggctac gccaacagct gcctcaaccc ctttgtgtac tgtgctct gcgagacgtt ccgcaaacgc ttggtccttt cggtgaagcc tgcagcccag gcagcttc gcgctgtcag caacgctcag acggctgacg aggagaggac agaaagcaaa tacctga 422 PRT Macaca fascicularis 56 Met Ser Val Arg Ala Ala Lys Glu Gly Val Gly Arg Ala Val Gly Leu Gly Gly Ser Gly Cys Gln Ala Ala Lys Glu Asp Pro Leu Pro Asp 2 Cys Gly Ala Cys Ala Pro Gly Gln Gly Gly Arg Arg Trp Arg Leu Pro 35 4n Pro Ala Trp Val Glu Gly Ser Ser Ala Trp Leu Trp Glu Pro Ala 5 Thr Gly Thr Gly Trp Met Asp Leu Glu Ala Ser Leu Leu Pro Thr Gly 65 7 Pro Asn Thr Ser Asn Thr Ser Asp Gly Pro Asp Asn Leu Thr Ser Ala 85 9y Ser Pro Pro Arg Ser Gly Ser Val Ser Tyr Ile Asn Ile Ile Met Ser Val Phe Gly Thr Ile Cys Leu Leu Gly Ile Ile Gly Asn Ser Val Ile Phe Ala Val Val Lys Lys Ser Lys Leu His Trp Cys Asn Val Pro Asp Ile Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met Pro Phe Met Ile His Gln Leu Met Gly Asn Gly Trp His Phe Gly Glu Thr Met Cys Thr Leu Ile Thr Ala Met Asp Asn Ser Gln Phe Thr Ser Thr Tyr Ile Leu Thr Ala Met Ala Ile 2Arg Tyr Leu Ala Thr Val His Pro Ile Ser Ser Thr Lys Phe Arg 222ro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser 225 234le Ser Ile Thr Pro Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe 245 25ro Gly Gly Ala Val Gly Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr 267eu Tyr Trp Phe Thr Leu Tyr Gln Phe Phe Leu Ala Phe Ala Leu 275 28ro Phe Val Val Ile Thr Ala Ala Tyr Val Arg Ile Leu Gln Arg Met 29Ser Ser Val Ala Pro Ala Ser Gln Arg Ser Ile Arg Leu Arg Thr 33Lys Arg Val Thr Arg Thr Ala Ile Ala Ile Cys Leu Val Phe Phe Val 325 33ys Trp Ala Pro Tyr Tyr Val Leu Gln Leu Thr Gln Leu Ser Ile Ser 345ro Thr Leu Thr Phe Val Tyr Leu Tyr Asn Ala Ala Ile Ser Leu 355 36ly Tyr Ala Asn Ser Cys Leu Asn Pro Phe Val Tyr Ile Val Leu Cys 378hr Phe Arg Lys Arg Leu Val Leu Ser Val Lys Pro Ala Ala Gln 385 39Gln Leu Arg Ala Val Ser Asn Ala Gln Thr Ala Asp Glu Glu Arg 44Glu Ser Lys Gly Thr 42 DNA Artificial Sequence MCHr reverse primer 57 cacaggaggc agatcaccag ggtggc 26 58 22 DNA Artificial Sequence MCHr reverse primer 58 ggtgctggtg aactgactat tg 22 |
